Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637714_a_at:

>probe:Drosophila_2:1637714_a_at:434:705; Interrogation_Position=129; Antisense; TTATCGCCAGCCAGCAGCGGGAAAT
>probe:Drosophila_2:1637714_a_at:579:9; Interrogation_Position=154; Antisense; ATTCTCAAAACCCTGATGTCCAAGG
>probe:Drosophila_2:1637714_a_at:259:223; Interrogation_Position=175; Antisense; AAGGGAGCCTCCCAGCCATGGCAAG
>probe:Drosophila_2:1637714_a_at:577:79; Interrogation_Position=224; Antisense; AGGGTCGCTTGGATGGAACCGCTCT
>probe:Drosophila_2:1637714_a_at:619:549; Interrogation_Position=252; Antisense; GGAGTACTTTGCTCCACTGGAGGAA
>probe:Drosophila_2:1637714_a_at:195:561; Interrogation_Position=320; Antisense; GGAACTACGATGGTGACTACTGCAA
>probe:Drosophila_2:1637714_a_at:418:287; Interrogation_Position=362; Antisense; CTGGCTTGCAGGTCTTTGGTGGATA
>probe:Drosophila_2:1637714_a_at:611:5; Interrogation_Position=420; Antisense; ATTCCTATACCCACTGATCTTGCTG
>probe:Drosophila_2:1637714_a_at:488:453; Interrogation_Position=435; Antisense; GATCTTGCTGATTTACCTTTACTTC
>probe:Drosophila_2:1637714_a_at:450:671; Interrogation_Position=448; Antisense; TACCTTTACTTCAGCCTACGTTTAT
>probe:Drosophila_2:1637714_a_at:615:395; Interrogation_Position=476; Antisense; GAAATTCTGTCGTTTACATGCTAAC
>probe:Drosophila_2:1637714_a_at:216:601; Interrogation_Position=535; Antisense; TGTTGTTCCACTTAATACTTCCGCT
>probe:Drosophila_2:1637714_a_at:198:29; Interrogation_Position=549; Antisense; ATACTTCCGCTTATTCAAGTCGCAC
>probe:Drosophila_2:1637714_a_at:450:91; Interrogation_Position=83; Antisense; AGTATGTGCCCGGTGATCCTAGGAA

Paste this into a BLAST search page for me
TTATCGCCAGCCAGCAGCGGGAAATATTCTCAAAACCCTGATGTCCAAGGAAGGGAGCCTCCCAGCCATGGCAAGAGGGTCGCTTGGATGGAACCGCTCTGGAGTACTTTGCTCCACTGGAGGAAGGAACTACGATGGTGACTACTGCAACTGGCTTGCAGGTCTTTGGTGGATAATTCCTATACCCACTGATCTTGCTGGATCTTGCTGATTTACCTTTACTTCTACCTTTACTTCAGCCTACGTTTATGAAATTCTGTCGTTTACATGCTAACTGTTGTTCCACTTAATACTTCCGCTATACTTCCGCTTATTCAAGTCGCACAGTATGTGCCCGGTGATCCTAGGAA

Full Affymetrix probeset data:

Annotations for 1637714_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime