Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637715_a_at:

>probe:Drosophila_2:1637715_a_at:413:579; Interrogation_Position=548; Antisense; GGCCATTGAAATCCTGCGAAGCCAA
>probe:Drosophila_2:1637715_a_at:554:597; Interrogation_Position=605; Antisense; TGTCATGGATGCCACGCTGGATCAT
>probe:Drosophila_2:1637715_a_at:142:723; Interrogation_Position=629; Antisense; TTGGCAGGTGCCCTTCGAGGAAAAC
>probe:Drosophila_2:1637715_a_at:549:513; Interrogation_Position=669; Antisense; GTGATGATTTTTGTGCTGTCCGCAA
>probe:Drosophila_2:1637715_a_at:530:597; Interrogation_Position=680; Antisense; TGTGCTGTCCGCAATTGAGCCAAAG
>probe:Drosophila_2:1637715_a_at:212:729; Interrogation_Position=720; Antisense; TTGGACAATTGCTATCGCTACCTGC
>probe:Drosophila_2:1637715_a_at:686:403; Interrogation_Position=771; Antisense; GACTACGGACGATACGACCTGGCAC
>probe:Drosophila_2:1637715_a_at:9:259; Interrogation_Position=793; Antisense; CACAGCTGCGCTTCAAGAGCGGCAA
>probe:Drosophila_2:1637715_a_at:442:437; Interrogation_Position=825; Antisense; GAGGACAACTTCTACGTGCGAGGCG
>probe:Drosophila_2:1637715_a_at:82:355; Interrogation_Position=853; Antisense; GCACCATGGTGTACTTCTTCACGGA
>probe:Drosophila_2:1637715_a_at:422:437; Interrogation_Position=918; Antisense; GAGGAGCAGCTCATTGTGGACCGAA
>probe:Drosophila_2:1637715_a_at:467:135; Interrogation_Position=944; Antisense; ACTGCAAGTTAATCGCTGTCGCGGC
>probe:Drosophila_2:1637715_a_at:409:297; Interrogation_Position=957; Antisense; CGCTGTCGCGGCTTGAAAATGTACC
>probe:Drosophila_2:1637715_a_at:679:165; Interrogation_Position=973; Antisense; AAATGTACCGCGTGTGGATTCAGAC

Paste this into a BLAST search page for me
GGCCATTGAAATCCTGCGAAGCCAATGTCATGGATGCCACGCTGGATCATTTGGCAGGTGCCCTTCGAGGAAAACGTGATGATTTTTGTGCTGTCCGCAATGTGCTGTCCGCAATTGAGCCAAAGTTGGACAATTGCTATCGCTACCTGCGACTACGGACGATACGACCTGGCACCACAGCTGCGCTTCAAGAGCGGCAAGAGGACAACTTCTACGTGCGAGGCGGCACCATGGTGTACTTCTTCACGGAGAGGAGCAGCTCATTGTGGACCGAAACTGCAAGTTAATCGCTGTCGCGGCCGCTGTCGCGGCTTGAAAATGTACCAAATGTACCGCGTGTGGATTCAGAC

Full Affymetrix probeset data:

Annotations for 1637715_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime