Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637717_at:

>probe:Drosophila_2:1637717_at:422:487; Interrogation_Position=8180; Antisense; GTACGGAGAAGCTTTACTCCCTGCT
>probe:Drosophila_2:1637717_at:261:619; Interrogation_Position=8207; Antisense; TGCTTTGCTGGCGAACGGATCCGTG
>probe:Drosophila_2:1637717_at:559:543; Interrogation_Position=8223; Antisense; GGATCCGTGGGAGCGACCCAGTTTC
>probe:Drosophila_2:1637717_at:442:49; Interrogation_Position=8270; Antisense; ATGCCATCAGCACCGATTTGCGGCG
>probe:Drosophila_2:1637717_at:188:169; Interrogation_Position=8300; Antisense; AAATGGCCTCGGCAACTGCGGATAC
>probe:Drosophila_2:1637717_at:41:457; Interrogation_Position=8320; Antisense; GATACGGTTGTCAGCTGCTCCAGGC
>probe:Drosophila_2:1637717_at:460:317; Interrogation_Position=8343; Antisense; GCCGGAGTTCAAGGTGCGATTCGAT
>probe:Drosophila_2:1637717_at:391:223; Interrogation_Position=8353; Antisense; AAGGTGCGATTCGATGGCCAGCCGC
>probe:Drosophila_2:1637717_at:669:505; Interrogation_Position=8437; Antisense; GTGCCGCTCAAGGATAAGCAACTGT
>probe:Drosophila_2:1637717_at:74:1; Interrogation_Position=8467; Antisense; AACGAGGGAGTCTCGCGACTTTAGA
>probe:Drosophila_2:1637717_at:363:675; Interrogation_Position=8488; Antisense; TAGAAAGGTGACTCCCATGTCCTTC
>probe:Drosophila_2:1637717_at:424:61; Interrogation_Position=8504; Antisense; ATGTCCTTCACAAAGGTCGTCTCAA
>probe:Drosophila_2:1637717_at:717:565; Interrogation_Position=8601; Antisense; GGCAAGTTTGTATTCTATTTCAGAT
>probe:Drosophila_2:1637717_at:312:251; Interrogation_Position=8668; Antisense; CAAGCGCATTGCCTATAAGTTTTAT

Paste this into a BLAST search page for me
GTACGGAGAAGCTTTACTCCCTGCTTGCTTTGCTGGCGAACGGATCCGTGGGATCCGTGGGAGCGACCCAGTTTCATGCCATCAGCACCGATTTGCGGCGAAATGGCCTCGGCAACTGCGGATACGATACGGTTGTCAGCTGCTCCAGGCGCCGGAGTTCAAGGTGCGATTCGATAAGGTGCGATTCGATGGCCAGCCGCGTGCCGCTCAAGGATAAGCAACTGTAACGAGGGAGTCTCGCGACTTTAGATAGAAAGGTGACTCCCATGTCCTTCATGTCCTTCACAAAGGTCGTCTCAAGGCAAGTTTGTATTCTATTTCAGATCAAGCGCATTGCCTATAAGTTTTAT

Full Affymetrix probeset data:

Annotations for 1637717_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime