FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637718_at:

>probe:Drosophila_2:1637718_at:263:453; Interrogation_Position=1008; Antisense; GATCATCAAGAAGGGCGAGCGCACT
>probe:Drosophila_2:1637718_at:272:81; Interrogation_Position=1043; Antisense; AGGTGTGCGATCTCTGGTTCCTGCG
>probe:Drosophila_2:1637718_at:471:191; Interrogation_Position=1075; Antisense; AACTTTACTCAGCACATCAACTCTT
>probe:Drosophila_2:1637718_at:311:653; Interrogation_Position=1091; Antisense; TCAACTCTTCCAGTCACATCGAAAA
>probe:Drosophila_2:1637718_at:398:377; Interrogation_Position=636; Antisense; GAAGCACACAATGCGCGTGGGCCGA
>probe:Drosophila_2:1637718_at:411:523; Interrogation_Position=654; Antisense; GGGCCGAAAGCTGATCCATGTAAAA
>probe:Drosophila_2:1637718_at:588:311; Interrogation_Position=696; Antisense; GCCAAAGCGTATTGTGGACCGCAAT
>probe:Drosophila_2:1637718_at:22:331; Interrogation_Position=755; Antisense; GCGGCCGGCAATTCAAAGACACCAG
>probe:Drosophila_2:1637718_at:486:471; Interrogation_Position=822; Antisense; GTTCGAGTGCGACCAGTGCCACCAG
>probe:Drosophila_2:1637718_at:498:87; Interrogation_Position=836; Antisense; AGTGCCACCAGAAGTGCTACACGCT
>probe:Drosophila_2:1637718_at:229:119; Interrogation_Position=881; Antisense; AGCTGAAGCACACGGAGGGTCCCTA
>probe:Drosophila_2:1637718_at:524:641; Interrogation_Position=917; Antisense; TCTGCGGCCTGGAGTACAGCACGAA
>probe:Drosophila_2:1637718_at:77:189; Interrogation_Position=940; Antisense; AACAGCTCGCGCGTGAGACATGAAA
>probe:Drosophila_2:1637718_at:674:407; Interrogation_Position=983; Antisense; GACGAGCGCCGCAATCCAAGTGGGA

Paste this into a BLAST search page for me
GATCATCAAGAAGGGCGAGCGCACTAGGTGTGCGATCTCTGGTTCCTGCGAACTTTACTCAGCACATCAACTCTTTCAACTCTTCCAGTCACATCGAAAAGAAGCACACAATGCGCGTGGGCCGAGGGCCGAAAGCTGATCCATGTAAAAGCCAAAGCGTATTGTGGACCGCAATGCGGCCGGCAATTCAAAGACACCAGGTTCGAGTGCGACCAGTGCCACCAGAGTGCCACCAGAAGTGCTACACGCTAGCTGAAGCACACGGAGGGTCCCTATCTGCGGCCTGGAGTACAGCACGAAAACAGCTCGCGCGTGAGACATGAAAGACGAGCGCCGCAATCCAAGTGGGA

Full Affymetrix probeset data:

Annotations for 1637718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720