Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637719_at:

>probe:Drosophila_2:1637719_at:283:305; Interrogation_Position=1796; Antisense; CCTCCGTTATCTATGACTACTTCAA
>probe:Drosophila_2:1637719_at:479:553; Interrogation_Position=1842; Antisense; GGAGCATTCGAATCGGTCGTCTATC
>probe:Drosophila_2:1637719_at:385:499; Interrogation_Position=1857; Antisense; GTCGTCTATCACCTTCCTGGAATTT
>probe:Drosophila_2:1637719_at:704:305; Interrogation_Position=1872; Antisense; CCTGGAATTTCTGCACGTGGAGTAT
>probe:Drosophila_2:1637719_at:517:683; Interrogation_Position=1894; Antisense; TATGCGGATCTTTTTGGCGATGCCT
>probe:Drosophila_2:1637719_at:422:235; Interrogation_Position=1943; Antisense; AATCCCGTGGACATACTGTTGCCGA
>probe:Drosophila_2:1637719_at:550:527; Interrogation_Position=2015; Antisense; GGGACCTCATAAAGAGCCCGCAGGA
>probe:Drosophila_2:1637719_at:713:101; Interrogation_Position=2064; Antisense; AGAGCAGCGAAGTGCCGACTACCGT
>probe:Drosophila_2:1637719_at:417:303; Interrogation_Position=2078; Antisense; CCGACTACCGTTTGCGCGGAGAGAA
>probe:Drosophila_2:1637719_at:341:253; Interrogation_Position=2109; Antisense; CAAGCTGATGGCTATCCTGAACCTC
>probe:Drosophila_2:1637719_at:124:381; Interrogation_Position=2127; Antisense; GAACCTCCAGGTTGAGATCCTCGAG
>probe:Drosophila_2:1637719_at:5:451; Interrogation_Position=2209; Antisense; GATCCCGACGACATGCCGGAAATGT
>probe:Drosophila_2:1637719_at:273:379; Interrogation_Position=2238; Antisense; GAAGCGCCGTTGATGATCGCCGTGA
>probe:Drosophila_2:1637719_at:373:191; Interrogation_Position=2325; Antisense; AACTACTTTGTTTTATGCCGCACGG

Paste this into a BLAST search page for me
CCTCCGTTATCTATGACTACTTCAAGGAGCATTCGAATCGGTCGTCTATCGTCGTCTATCACCTTCCTGGAATTTCCTGGAATTTCTGCACGTGGAGTATTATGCGGATCTTTTTGGCGATGCCTAATCCCGTGGACATACTGTTGCCGAGGGACCTCATAAAGAGCCCGCAGGAAGAGCAGCGAAGTGCCGACTACCGTCCGACTACCGTTTGCGCGGAGAGAACAAGCTGATGGCTATCCTGAACCTCGAACCTCCAGGTTGAGATCCTCGAGGATCCCGACGACATGCCGGAAATGTGAAGCGCCGTTGATGATCGCCGTGAAACTACTTTGTTTTATGCCGCACGG

Full Affymetrix probeset data:

Annotations for 1637719_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime