Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637720_at:

>probe:Drosophila_2:1637720_at:267:405; Interrogation_Position=1010; Antisense; GACTACAATTTGTGCCTTTAAGTGC
>probe:Drosophila_2:1637720_at:15:191; Interrogation_Position=1100; Antisense; AACATTTTCTTACTGCATTTGAACG
>probe:Drosophila_2:1637720_at:563:247; Interrogation_Position=1231; Antisense; AATTGCTTTACTATCTCGGACAAAA
>probe:Drosophila_2:1637720_at:697:395; Interrogation_Position=1334; Antisense; GAAATTTGTTGATGTGGCACCGTCA
>probe:Drosophila_2:1637720_at:213:567; Interrogation_Position=1349; Antisense; GGCACCGTCACTGCATGTTTTGACA
>probe:Drosophila_2:1637720_at:203:199; Interrogation_Position=810; Antisense; AACGACAGGCTGTCTTCGACGACGC
>probe:Drosophila_2:1637720_at:494:621; Interrogation_Position=825; Antisense; TCGACGACGCCTTCCGGGAGGATAT
>probe:Drosophila_2:1637720_at:360:75; Interrogation_Position=852; Antisense; AGGAGTACAAACAGCGCGGCCAGCT
>probe:Drosophila_2:1637720_at:570:323; Interrogation_Position=865; Antisense; GCGCGGCCAGCTGACAAAAATTCAA
>probe:Drosophila_2:1637720_at:208:95; Interrogation_Position=903; Antisense; AGTTGGCTCTGGAGGAAGTCGTCCT
>probe:Drosophila_2:1637720_at:108:373; Interrogation_Position=917; Antisense; GAAGTCGTCCTTGAAGCCAACGAAG
>probe:Drosophila_2:1637720_at:703:397; Interrogation_Position=946; Antisense; GACAAAGGATGCTCTGGAACAATTT
>probe:Drosophila_2:1637720_at:523:571; Interrogation_Position=977; Antisense; GGCTAACTCACATTGTTTGCTCATC
>probe:Drosophila_2:1637720_at:500:619; Interrogation_Position=994; Antisense; TGCTCATCTCGCAAAAGACTACAAT

Paste this into a BLAST search page for me
GACTACAATTTGTGCCTTTAAGTGCAACATTTTCTTACTGCATTTGAACGAATTGCTTTACTATCTCGGACAAAAGAAATTTGTTGATGTGGCACCGTCAGGCACCGTCACTGCATGTTTTGACAAACGACAGGCTGTCTTCGACGACGCTCGACGACGCCTTCCGGGAGGATATAGGAGTACAAACAGCGCGGCCAGCTGCGCGGCCAGCTGACAAAAATTCAAAGTTGGCTCTGGAGGAAGTCGTCCTGAAGTCGTCCTTGAAGCCAACGAAGGACAAAGGATGCTCTGGAACAATTTGGCTAACTCACATTGTTTGCTCATCTGCTCATCTCGCAAAAGACTACAAT

Full Affymetrix probeset data:

Annotations for 1637720_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime