FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637721_at:

>probe:Drosophila_2:1637721_at:111:279; Interrogation_Position=1003; Antisense; CTATCAAGCCGTGGGCGAACTTGTT
>probe:Drosophila_2:1637721_at:406:385; Interrogation_Position=1057; Antisense; GAACAAGCTTTGTGTGGGCCAACTC
>probe:Drosophila_2:1637721_at:152:597; Interrogation_Position=1067; Antisense; TGTGTGGGCCAACTCAAATAAATAA
>probe:Drosophila_2:1637721_at:80:181; Interrogation_Position=1090; Antisense; AAACAATCGCACTTGAATACAATGA
>probe:Drosophila_2:1637721_at:608:719; Interrogation_Position=815; Antisense; TTCCAAGTGACCAAATACCATTGCA
>probe:Drosophila_2:1637721_at:362:27; Interrogation_Position=829; Antisense; ATACCATTGCACCAGGAGTACATTG
>probe:Drosophila_2:1637721_at:332:429; Interrogation_Position=844; Antisense; GAGTACATTGCAGAAGTCTTCCGAC
>probe:Drosophila_2:1637721_at:413:373; Interrogation_Position=856; Antisense; GAAGTCTTCCGACAAGAGTTTATCA
>probe:Drosophila_2:1637721_at:494:527; Interrogation_Position=885; Antisense; GGGAACTCAATATAATATGCCTGTT
>probe:Drosophila_2:1637721_at:120:681; Interrogation_Position=900; Antisense; TATGCCTGTTGGAAGTAATACGTAA
>probe:Drosophila_2:1637721_at:20:37; Interrogation_Position=928; Antisense; ATCAGTGGCATGGAACACCGGCATA
>probe:Drosophila_2:1637721_at:489:129; Interrogation_Position=944; Antisense; ACCGGCATACACAAGCTGAGAATAG
>probe:Drosophila_2:1637721_at:42:727; Interrogation_Position=973; Antisense; TTGAGCCGGTGCAATATCATATTAC
>probe:Drosophila_2:1637721_at:693:685; Interrogation_Position=987; Antisense; TATCATATTACACTCACTATCAAGC

Paste this into a BLAST search page for me
CTATCAAGCCGTGGGCGAACTTGTTGAACAAGCTTTGTGTGGGCCAACTCTGTGTGGGCCAACTCAAATAAATAAAAACAATCGCACTTGAATACAATGATTCCAAGTGACCAAATACCATTGCAATACCATTGCACCAGGAGTACATTGGAGTACATTGCAGAAGTCTTCCGACGAAGTCTTCCGACAAGAGTTTATCAGGGAACTCAATATAATATGCCTGTTTATGCCTGTTGGAAGTAATACGTAAATCAGTGGCATGGAACACCGGCATAACCGGCATACACAAGCTGAGAATAGTTGAGCCGGTGCAATATCATATTACTATCATATTACACTCACTATCAAGC

Full Affymetrix probeset data:

Annotations for 1637721_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720