FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637723_at:

>probe:Drosophila_2:1637723_at:517:155; Interrogation_Position=1363; Antisense; ACAGAGGCTCAAGGACATCTTTCGA
>probe:Drosophila_2:1637723_at:129:225; Interrogation_Position=1373; Antisense; AAGGACATCTTTCGACATTGCGCCA
>probe:Drosophila_2:1637723_at:93:151; Interrogation_Position=1387; Antisense; ACATTGCGCCATCTCCCAGTTGAGG
>probe:Drosophila_2:1637723_at:26:71; Interrogation_Position=1409; Antisense; AGGCCATATTTGATGCGGACGGCAA
>probe:Drosophila_2:1637723_at:234:51; Interrogation_Position=1421; Antisense; ATGCGGACGGCAAACAGATGGACTT
>probe:Drosophila_2:1637723_at:339:441; Interrogation_Position=1437; Antisense; GATGGACTTCATACCCAACATTCGC
>probe:Drosophila_2:1637723_at:698:189; Interrogation_Position=1453; Antisense; AACATTCGCGTCATCCGAAGTCAGC
>probe:Drosophila_2:1637723_at:454:331; Interrogation_Position=1476; Antisense; GCGGAAGACCATAAAGCTGATGTTT
>probe:Drosophila_2:1637723_at:239:163; Interrogation_Position=1504; Antisense; AAATATGCCTACTCGAAGACCAACG
>probe:Drosophila_2:1637723_at:279:213; Interrogation_Position=1519; Antisense; AAGACCAACGAGCACGATACCACAA
>probe:Drosophila_2:1637723_at:325:203; Interrogation_Position=1542; Antisense; AACCTACTGGCACTGCCGAAGTCGT
>probe:Drosophila_2:1637723_at:571:297; Interrogation_Position=1557; Antisense; CCGAAGTCGTCGCAATGGAAGGCCT
>probe:Drosophila_2:1637723_at:311:615; Interrogation_Position=1585; Antisense; TGCAAGGCCCGGTTTTCCACCAAGA
>probe:Drosophila_2:1637723_at:580:171; Interrogation_Position=1630; Antisense; AAAGTATATCTGACCCAGCCGGAGC

Paste this into a BLAST search page for me
ACAGAGGCTCAAGGACATCTTTCGAAAGGACATCTTTCGACATTGCGCCAACATTGCGCCATCTCCCAGTTGAGGAGGCCATATTTGATGCGGACGGCAAATGCGGACGGCAAACAGATGGACTTGATGGACTTCATACCCAACATTCGCAACATTCGCGTCATCCGAAGTCAGCGCGGAAGACCATAAAGCTGATGTTTAAATATGCCTACTCGAAGACCAACGAAGACCAACGAGCACGATACCACAAAACCTACTGGCACTGCCGAAGTCGTCCGAAGTCGTCGCAATGGAAGGCCTTGCAAGGCCCGGTTTTCCACCAAGAAAAGTATATCTGACCCAGCCGGAGC

Full Affymetrix probeset data:

Annotations for 1637723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720