Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637724_s_at:

>probe:Drosophila_2:1637724_s_at:515:599; Interrogation_Position=1000; Antisense; TGTACCCACCAACGTTTACTTCAAT
>probe:Drosophila_2:1637724_s_at:121:149; Interrogation_Position=1017; Antisense; ACTTCAATCCGGAATCTGTGGCCAT
>probe:Drosophila_2:1637724_s_at:273:251; Interrogation_Position=1057; Antisense; CAAGGCGCATGCTACGGCGGATTTG
>probe:Drosophila_2:1637724_s_at:658:335; Interrogation_Position=557; Antisense; GCTCTGCCTGCAGTGAAGACCCGAA
>probe:Drosophila_2:1637724_s_at:68:283; Interrogation_Position=611; Antisense; CTCCGCTCAGCGGTCAGCAAAATAA
>probe:Drosophila_2:1637724_s_at:13:43; Interrogation_Position=650; Antisense; ATCGAAGAGATCGTTCCGGTGCCGG
>probe:Drosophila_2:1637724_s_at:425:505; Interrogation_Position=668; Antisense; GTGCCGGGCAAGCTAGTGATCTCCA
>probe:Drosophila_2:1637724_s_at:724:467; Interrogation_Position=776; Antisense; GTTCCCTTGAAGGTTGAGGCCACCG
>probe:Drosophila_2:1637724_s_at:455:391; Interrogation_Position=801; Antisense; GAAAGACCAGCACGAGTTCCGGCAA
>probe:Drosophila_2:1637724_s_at:408:191; Interrogation_Position=824; Antisense; AACTTTCCGCAGATCCCATTTGGAA
>probe:Drosophila_2:1637724_s_at:407:19; Interrogation_Position=841; Antisense; ATTTGGAAACTACTTCCTGCCCTAT
>probe:Drosophila_2:1637724_s_at:590:71; Interrogation_Position=876; Antisense; AGGCTCAGGCGATCCAGGGACGCAA
>probe:Drosophila_2:1637724_s_at:401:561; Interrogation_Position=919; Antisense; GGAACCTCATTCCAAAGCGGTGGTT
>probe:Drosophila_2:1637724_s_at:675:321; Interrogation_Position=970; Antisense; GCCCATTTCCAAGGCGTATCTGAAG

Paste this into a BLAST search page for me
TGTACCCACCAACGTTTACTTCAATACTTCAATCCGGAATCTGTGGCCATCAAGGCGCATGCTACGGCGGATTTGGCTCTGCCTGCAGTGAAGACCCGAACTCCGCTCAGCGGTCAGCAAAATAAATCGAAGAGATCGTTCCGGTGCCGGGTGCCGGGCAAGCTAGTGATCTCCAGTTCCCTTGAAGGTTGAGGCCACCGGAAAGACCAGCACGAGTTCCGGCAAAACTTTCCGCAGATCCCATTTGGAAATTTGGAAACTACTTCCTGCCCTATAGGCTCAGGCGATCCAGGGACGCAAGGAACCTCATTCCAAAGCGGTGGTTGCCCATTTCCAAGGCGTATCTGAAG

Full Affymetrix probeset data:

Annotations for 1637724_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime