FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637728_at:

>probe:Drosophila_2:1637728_at:258:587; Interrogation_Position=435; Antisense; TGGAGAAACCTACATGCTCGTGCCC
>probe:Drosophila_2:1637728_at:655:337; Interrogation_Position=450; Antisense; GCTCGTGCCCATTGATATAAACATA
>probe:Drosophila_2:1637728_at:396:409; Interrogation_Position=481; Antisense; GACGATACCGAAATAACTCCTGATA
>probe:Drosophila_2:1637728_at:396:145; Interrogation_Position=496; Antisense; ACTCCTGATACTTCCACAAAGCGTA
>probe:Drosophila_2:1637728_at:298:483; Interrogation_Position=518; Antisense; GTATCACCGAAAATGACGCCTACAA
>probe:Drosophila_2:1637728_at:41:409; Interrogation_Position=546; Antisense; GACGGGAGCGGGACACACCATCTAT
>probe:Drosophila_2:1637728_at:183:129; Interrogation_Position=562; Antisense; ACCATCTATATGCATCCCGAACAAG
>probe:Drosophila_2:1637728_at:47:213; Interrogation_Position=650; Antisense; AAGAGCAGACCAACTACGACTACCA
>probe:Drosophila_2:1637728_at:730:403; Interrogation_Position=667; Antisense; GACTACCACATGCACACTTTCGAGG
>probe:Drosophila_2:1637728_at:617:321; Interrogation_Position=693; Antisense; GCCCAAGCTGAGTTTTCCCTTTGAA
>probe:Drosophila_2:1637728_at:401:117; Interrogation_Position=816; Antisense; AGCTACCGAGCTTCAGGACGTCCTA
>probe:Drosophila_2:1637728_at:226:453; Interrogation_Position=860; Antisense; GATCATCTTGCTTTTTAACGCCATC
>probe:Drosophila_2:1637728_at:117:677; Interrogation_Position=918; Antisense; TAGCTTTCCAAGTTAGGTGCCTCTC
>probe:Drosophila_2:1637728_at:593:677; Interrogation_Position=931; Antisense; TAGGTGCCTCTCGTTAACTAAATCT

Paste this into a BLAST search page for me
TGGAGAAACCTACATGCTCGTGCCCGCTCGTGCCCATTGATATAAACATAGACGATACCGAAATAACTCCTGATAACTCCTGATACTTCCACAAAGCGTAGTATCACCGAAAATGACGCCTACAAGACGGGAGCGGGACACACCATCTATACCATCTATATGCATCCCGAACAAGAAGAGCAGACCAACTACGACTACCAGACTACCACATGCACACTTTCGAGGGCCCAAGCTGAGTTTTCCCTTTGAAAGCTACCGAGCTTCAGGACGTCCTAGATCATCTTGCTTTTTAACGCCATCTAGCTTTCCAAGTTAGGTGCCTCTCTAGGTGCCTCTCGTTAACTAAATCT

Full Affymetrix probeset data:

Annotations for 1637728_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720