FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637730_at:

>probe:Drosophila_2:1637730_at:657:385; Interrogation_Position=292; Antisense; GAAAATTTGCGAACCGTGCCTTATT
>probe:Drosophila_2:1637730_at:534:377; Interrogation_Position=302; Antisense; GAACCGTGCCTTATTAAATTGCGTG
>probe:Drosophila_2:1637730_at:536:663; Interrogation_Position=316; Antisense; TAAATTGCGTGAGGCCTTGAGATTC
>probe:Drosophila_2:1637730_at:642:271; Interrogation_Position=331; Antisense; CTTGAGATTCAGGAGACGCTACACA
>probe:Drosophila_2:1637730_at:88:425; Interrogation_Position=343; Antisense; GAGACGCTACACAAGGACCATGGAA
>probe:Drosophila_2:1637730_at:504:129; Interrogation_Position=359; Antisense; ACCATGGAATACGTGGCGCGCGTGA
>probe:Drosophila_2:1637730_at:595:105; Interrogation_Position=405; Antisense; AGACATGCGATCTCCTGGAGGCCGA
>probe:Drosophila_2:1637730_at:37:467; Interrogation_Position=431; Antisense; GATTGGGATTTTACGGATCGCATCA
>probe:Drosophila_2:1637730_at:486:79; Interrogation_Position=528; Antisense; AGGTGGATAAGAGGCGGCCCTTCAA
>probe:Drosophila_2:1637730_at:409:91; Interrogation_Position=572; Antisense; AGTTTCACCGGCAAGGCCCAGTTGA
>probe:Drosophila_2:1637730_at:489:227; Interrogation_Position=584; Antisense; AAGGCCCAGTTGACCATGCACAGGC
>probe:Drosophila_2:1637730_at:416:117; Interrogation_Position=646; Antisense; AGCTCTTAAATAGTCCTTGGCAACG
>probe:Drosophila_2:1637730_at:534:85; Interrogation_Position=657; Antisense; AGTCCTTGGCAACGCTTGGCAAAAT
>probe:Drosophila_2:1637730_at:304:237; Interrogation_Position=853; Antisense; AATCGGATCGATTCACAACAGTTTT

Paste this into a BLAST search page for me
GAAAATTTGCGAACCGTGCCTTATTGAACCGTGCCTTATTAAATTGCGTGTAAATTGCGTGAGGCCTTGAGATTCCTTGAGATTCAGGAGACGCTACACAGAGACGCTACACAAGGACCATGGAAACCATGGAATACGTGGCGCGCGTGAAGACATGCGATCTCCTGGAGGCCGAGATTGGGATTTTACGGATCGCATCAAGGTGGATAAGAGGCGGCCCTTCAAAGTTTCACCGGCAAGGCCCAGTTGAAAGGCCCAGTTGACCATGCACAGGCAGCTCTTAAATAGTCCTTGGCAACGAGTCCTTGGCAACGCTTGGCAAAATAATCGGATCGATTCACAACAGTTTT

Full Affymetrix probeset data:

Annotations for 1637730_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720