FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637731_at:

>probe:Drosophila_2:1637731_at:488:611; Interrogation_Position=111; Antisense; TGACGTTAACCTGCCGCCGATCGGA
>probe:Drosophila_2:1637731_at:652:293; Interrogation_Position=128; Antisense; CGATCGGAGACAACTGCTGGTGCAG
>probe:Drosophila_2:1637731_at:705:193; Interrogation_Position=176; Antisense; AACTGCCCAAGACCTGCGGAAAAGT
>probe:Drosophila_2:1637731_at:72:317; Interrogation_Position=19; Antisense; GCCTGCGTGTGCTCCGAAAAGGGAA
>probe:Drosophila_2:1637731_at:299:489; Interrogation_Position=199; Antisense; GTACGTGAGCTGTTCCAATACATGA
>probe:Drosophila_2:1637731_at:497:55; Interrogation_Position=220; Antisense; ATGAACGCCTTCAACAACCTCTTGG
>probe:Drosophila_2:1637731_at:674:651; Interrogation_Position=230; Antisense; TCAACAACCTCTTGGGCCGTCGGAT
>probe:Drosophila_2:1637731_at:453:639; Interrogation_Position=249; Antisense; TCGGATGCTCGAGGGCGCCATCGAA
>probe:Drosophila_2:1637731_at:28:45; Interrogation_Position=268; Antisense; ATCGAAGCCAAGACGCTGGCGGCAC
>probe:Drosophila_2:1637731_at:542:499; Interrogation_Position=317; Antisense; GTCTGGAGCGGATCGACTGCTTCAA
>probe:Drosophila_2:1637731_at:150:223; Interrogation_Position=37; Antisense; AAGGGAACGGACTACTGCCAAAGCT
>probe:Drosophila_2:1637731_at:238:405; Interrogation_Position=46; Antisense; GACTACTGCCAAAGCTGTCAGGGAT
>probe:Drosophila_2:1637731_at:41:81; Interrogation_Position=65; Antisense; AGGGATCCACGGTCATCCGGCCGAA
>probe:Drosophila_2:1637731_at:49:29; Interrogation_Position=96; Antisense; ATACTACGAGCCCAGTGACGTTAAC

Paste this into a BLAST search page for me
TGACGTTAACCTGCCGCCGATCGGACGATCGGAGACAACTGCTGGTGCAGAACTGCCCAAGACCTGCGGAAAAGTGCCTGCGTGTGCTCCGAAAAGGGAAGTACGTGAGCTGTTCCAATACATGAATGAACGCCTTCAACAACCTCTTGGTCAACAACCTCTTGGGCCGTCGGATTCGGATGCTCGAGGGCGCCATCGAAATCGAAGCCAAGACGCTGGCGGCACGTCTGGAGCGGATCGACTGCTTCAAAAGGGAACGGACTACTGCCAAAGCTGACTACTGCCAAAGCTGTCAGGGATAGGGATCCACGGTCATCCGGCCGAAATACTACGAGCCCAGTGACGTTAAC

Full Affymetrix probeset data:

Annotations for 1637731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720