FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637732_at:

>probe:Drosophila_2:1637732_at:379:473; Interrogation_Position=1107; Antisense; GTTCAGCATCAACTTCAGGGCCAAA
>probe:Drosophila_2:1637732_at:292:57; Interrogation_Position=617; Antisense; ATGAGATGTGGTCCATACGCCGTTT
>probe:Drosophila_2:1637732_at:165:477; Interrogation_Position=638; Antisense; GTTTATCCCTGCAGAAATTGGCCAA
>probe:Drosophila_2:1637732_at:593:31; Interrogation_Position=677; Antisense; ATAACTCTTTGTGGCAGGCTATCCG
>probe:Drosophila_2:1637732_at:382:69; Interrogation_Position=692; Antisense; AGGCTATCCGTTGTCTGGAGTGCTA
>probe:Drosophila_2:1637732_at:320:339; Interrogation_Position=713; Antisense; GCTACTTTCAACTGAGCCTGATCAC
>probe:Drosophila_2:1637732_at:225:317; Interrogation_Position=728; Antisense; GCCTGATCACACTGCTCATGAAGTT
>probe:Drosophila_2:1637732_at:348:645; Interrogation_Position=755; Antisense; TCATCGATACTTCTGCTTTGCCATA
>probe:Drosophila_2:1637732_at:418:29; Interrogation_Position=777; Antisense; ATACTGGCTCTACCTCAGCAGAGTT
>probe:Drosophila_2:1637732_at:122:671; Interrogation_Position=829; Antisense; TACGTCGCTACGGTTGAGTGCATCA
>probe:Drosophila_2:1637732_at:306:707; Interrogation_Position=859; Antisense; TTAGAGATTGTAGTGCCCTGCTATC
>probe:Drosophila_2:1637732_at:697:619; Interrogation_Position=877; Antisense; TGCTATCTCTGCACGCGATGTGATG
>probe:Drosophila_2:1637732_at:698:323; Interrogation_Position=909; Antisense; GCGAAAGTTCCTATCGATGTTCTAC
>probe:Drosophila_2:1637732_at:406:441; Interrogation_Position=924; Antisense; GATGTTCTACACAGTCACTACCGAT

Paste this into a BLAST search page for me
GTTCAGCATCAACTTCAGGGCCAAAATGAGATGTGGTCCATACGCCGTTTGTTTATCCCTGCAGAAATTGGCCAAATAACTCTTTGTGGCAGGCTATCCGAGGCTATCCGTTGTCTGGAGTGCTAGCTACTTTCAACTGAGCCTGATCACGCCTGATCACACTGCTCATGAAGTTTCATCGATACTTCTGCTTTGCCATAATACTGGCTCTACCTCAGCAGAGTTTACGTCGCTACGGTTGAGTGCATCATTAGAGATTGTAGTGCCCTGCTATCTGCTATCTCTGCACGCGATGTGATGGCGAAAGTTCCTATCGATGTTCTACGATGTTCTACACAGTCACTACCGAT

Full Affymetrix probeset data:

Annotations for 1637732_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720