Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637733_at:

>probe:Drosophila_2:1637733_at:173:139; Interrogation_Position=1044; Antisense; ACGATGTGCCCGTGGAACGCATTGA
>probe:Drosophila_2:1637733_at:434:41; Interrogation_Position=1087; Antisense; ATCTGGAGTTGGTTCATCGGGTGCC
>probe:Drosophila_2:1637733_at:373:535; Interrogation_Position=1106; Antisense; GGTGCCAAGCAGACCATGTACTACT
>probe:Drosophila_2:1637733_at:225:599; Interrogation_Position=1122; Antisense; TGTACTACTGCGAGGTGACCGATGC
>probe:Drosophila_2:1637733_at:593:441; Interrogation_Position=1279; Antisense; GATGTGGTTCTTCGCCAACAGGGCA
>probe:Drosophila_2:1637733_at:355:325; Interrogation_Position=1324; Antisense; GCGAACGCTGTTGCTGTTGATTCAC
>probe:Drosophila_2:1637733_at:428:603; Interrogation_Position=1341; Antisense; TGATTCACCCAGATAAGCGGCGGCC
>probe:Drosophila_2:1637733_at:327:121; Interrogation_Position=1356; Antisense; AGCGGCGGCCGTGATAAGATGATAA
>probe:Drosophila_2:1637733_at:500:353; Interrogation_Position=1404; Antisense; GCAGCGTTGCCTTATACACATCTTT
>probe:Drosophila_2:1637733_at:499:703; Interrogation_Position=1428; Antisense; TTAGTCAACACCAACCATTTCGAAT
>probe:Drosophila_2:1637733_at:367:15; Interrogation_Position=1444; Antisense; ATTTCGAATGCTTTCCAACCGAGCG
>probe:Drosophila_2:1637733_at:398:655; Interrogation_Position=1498; Antisense; TAATACTGAAATTCCCGTGCCTGTC
>probe:Drosophila_2:1637733_at:401:317; Interrogation_Position=1516; Antisense; GCCTGTCGAGGCTTACCTTATGATA
>probe:Drosophila_2:1637733_at:266:61; Interrogation_Position=1556; Antisense; ATGTAATAAACCCTGGCCAGCTGTC

Paste this into a BLAST search page for me
ACGATGTGCCCGTGGAACGCATTGAATCTGGAGTTGGTTCATCGGGTGCCGGTGCCAAGCAGACCATGTACTACTTGTACTACTGCGAGGTGACCGATGCGATGTGGTTCTTCGCCAACAGGGCAGCGAACGCTGTTGCTGTTGATTCACTGATTCACCCAGATAAGCGGCGGCCAGCGGCGGCCGTGATAAGATGATAAGCAGCGTTGCCTTATACACATCTTTTTAGTCAACACCAACCATTTCGAATATTTCGAATGCTTTCCAACCGAGCGTAATACTGAAATTCCCGTGCCTGTCGCCTGTCGAGGCTTACCTTATGATAATGTAATAAACCCTGGCCAGCTGTC

Full Affymetrix probeset data:

Annotations for 1637733_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime