FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637734_at:

>probe:Drosophila_2:1637734_at:75:217; Interrogation_Position=3682; Antisense; AAGTTCAGCTGACGTACCGCTACAA
>probe:Drosophila_2:1637734_at:25:439; Interrogation_Position=3720; Antisense; GAGGCGAGACCCAGCTTCAAATTAA
>probe:Drosophila_2:1637734_at:242:663; Interrogation_Position=3767; Antisense; TAAAGGCCGACTGATCCTTGGCATT
>probe:Drosophila_2:1637734_at:701:47; Interrogation_Position=3780; Antisense; ATCCTTGGCATTTGTGGCACGTACA
>probe:Drosophila_2:1637734_at:338:349; Interrogation_Position=3854; Antisense; GCAGGTGCAGCTACCATCTGGTTAT
>probe:Drosophila_2:1637734_at:645:57; Interrogation_Position=3877; Antisense; ATGTTTGCGATATCGAGCCCTTTGC
>probe:Drosophila_2:1637734_at:713:13; Interrogation_Position=3970; Antisense; ATTTCGAAAAGCTGTCACCTGGTGA
>probe:Drosophila_2:1637734_at:6:679; Interrogation_Position=4012; Antisense; TAGAGGCCATATACACCCATGCGGT
>probe:Drosophila_2:1637734_at:322:1; Interrogation_Position=4054; Antisense; CTTGGGTTCGGCTCTATGATTACTA
>probe:Drosophila_2:1637734_at:469:603; Interrogation_Position=4070; Antisense; TGATTACTATGCCACCGAACGCAGT
>probe:Drosophila_2:1637734_at:577:199; Interrogation_Position=4087; Antisense; AACGCAGTGCTACCGAATTCTATCA
>probe:Drosophila_2:1637734_at:259:33; Interrogation_Position=4108; Antisense; ATCACGTGGACACTTCTCTGTGTGA
>probe:Drosophila_2:1637734_at:719:641; Interrogation_Position=4124; Antisense; TCTGTGTGACATTTGCCACGGCAAC
>probe:Drosophila_2:1637734_at:80:485; Interrogation_Position=4182; Antisense; GTATGCGTTATTTCTATGCCTACAA

Paste this into a BLAST search page for me
AAGTTCAGCTGACGTACCGCTACAAGAGGCGAGACCCAGCTTCAAATTAATAAAGGCCGACTGATCCTTGGCATTATCCTTGGCATTTGTGGCACGTACAGCAGGTGCAGCTACCATCTGGTTATATGTTTGCGATATCGAGCCCTTTGCATTTCGAAAAGCTGTCACCTGGTGATAGAGGCCATATACACCCATGCGGTCTTGGGTTCGGCTCTATGATTACTATGATTACTATGCCACCGAACGCAGTAACGCAGTGCTACCGAATTCTATCAATCACGTGGACACTTCTCTGTGTGATCTGTGTGACATTTGCCACGGCAACGTATGCGTTATTTCTATGCCTACAA

Full Affymetrix probeset data:

Annotations for 1637734_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720