FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637735_at:

>probe:Drosophila_2:1637735_at:673:61; Interrogation_Position=228; Antisense; ATGTCCTGCATTGTCCAGCGTCTGT
>probe:Drosophila_2:1637735_at:505:503; Interrogation_Position=251; Antisense; GTCCAAGTCGCTGAACCGTGAAATG
>probe:Drosophila_2:1637735_at:375:167; Interrogation_Position=271; Antisense; AAATGCCCAGCGAGCTGATCTGGCG
>probe:Drosophila_2:1637735_at:574:131; Interrogation_Position=298; Antisense; ACCTGGGCACCATGTACAAGCTGAA
>probe:Drosophila_2:1637735_at:42:227; Interrogation_Position=321; Antisense; AAGGAACTGGACGATCTGGAGTCGC
>probe:Drosophila_2:1637735_at:121:199; Interrogation_Position=357; Antisense; AACGAGGAGCGCGAGTTCAGCCTGC
>probe:Drosophila_2:1637735_at:495:75; Interrogation_Position=388; Antisense; AGGATTACGGAACGCTACAGACCAA
>probe:Drosophila_2:1637735_at:478:105; Interrogation_Position=415; Antisense; AGACGGTGGAAGTGCATGCCAACGA
>probe:Drosophila_2:1637735_at:12:425; Interrogation_Position=477; Antisense; GAGACCAATGGCAAAGCTCCACCTG
>probe:Drosophila_2:1637735_at:615:487; Interrogation_Position=516; Antisense; GTACCGACGAATTCCACCAAGGACG
>probe:Drosophila_2:1637735_at:399:205; Interrogation_Position=666; Antisense; AAGCGCCGTCGCATATAGGTGACCC
>probe:Drosophila_2:1637735_at:301:297; Interrogation_Position=690; Antisense; CCCGCCCGAAACTGACGATTGTTGA
>probe:Drosophila_2:1637735_at:598:465; Interrogation_Position=706; Antisense; GATTGTTGATCCGTTTTAGCTCATT
>probe:Drosophila_2:1637735_at:628:115; Interrogation_Position=723; Antisense; AGCTCATTAGTTTTACTGTACTCTA

Paste this into a BLAST search page for me
ATGTCCTGCATTGTCCAGCGTCTGTGTCCAAGTCGCTGAACCGTGAAATGAAATGCCCAGCGAGCTGATCTGGCGACCTGGGCACCATGTACAAGCTGAAAAGGAACTGGACGATCTGGAGTCGCAACGAGGAGCGCGAGTTCAGCCTGCAGGATTACGGAACGCTACAGACCAAAGACGGTGGAAGTGCATGCCAACGAGAGACCAATGGCAAAGCTCCACCTGGTACCGACGAATTCCACCAAGGACGAAGCGCCGTCGCATATAGGTGACCCCCCGCCCGAAACTGACGATTGTTGAGATTGTTGATCCGTTTTAGCTCATTAGCTCATTAGTTTTACTGTACTCTA

Full Affymetrix probeset data:

Annotations for 1637735_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720