FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637737_at:

>probe:Drosophila_2:1637737_at:345:261; Interrogation_Position=113; Antisense; CAGCCCAAAATGTCCTTCGTTAAGA
>probe:Drosophila_2:1637737_at:87:109; Interrogation_Position=177; Antisense; AGAACCGCAGCTACTCGGATGAGAT
>probe:Drosophila_2:1637737_at:304:57; Interrogation_Position=195; Antisense; ATGAGATGAAGCTGACCTTCGCCGC
>probe:Drosophila_2:1637737_at:53:313; Interrogation_Position=221; Antisense; GCCAACAAAACCTTCTACGATGCCG
>probe:Drosophila_2:1637737_at:460:671; Interrogation_Position=236; Antisense; TACGATGCCGCTGTGGTGCGCCAAA
>probe:Drosophila_2:1637737_at:42:593; Interrogation_Position=249; Antisense; TGGTGCGCCAAATCGATGTGCCTTC
>probe:Drosophila_2:1637737_at:513:65; Interrogation_Position=360; Antisense; ATGGCAAGACCCTCAAGTTCTTCGT
>probe:Drosophila_2:1637737_at:421:541; Interrogation_Position=392; Antisense; GGTTCCGTCACCGTCAACGAGGATT
>probe:Drosophila_2:1637737_at:682:435; Interrogation_Position=410; Antisense; GAGGATTCCTCCGTTCAGGTTCTGG
>probe:Drosophila_2:1637737_at:24:397; Interrogation_Position=493; Antisense; GAAATACCAGTCACAGCTTAGCTCC
>probe:Drosophila_2:1637737_at:586:623; Interrogation_Position=547; Antisense; TGCCATTGCCGTGGAGGTCGCCGAA
>probe:Drosophila_2:1637737_at:451:377; Interrogation_Position=569; Antisense; GAAGCGTTAGTCAAGGCTGCCGAAT
>probe:Drosophila_2:1637737_at:71:573; Interrogation_Position=583; Antisense; GGCTGCCGAATAGACGTAATCACCA
>probe:Drosophila_2:1637737_at:527:701; Interrogation_Position=76; Antisense; TTTTCTCGTGTTTTTCGCTATCAAA

Paste this into a BLAST search page for me
CAGCCCAAAATGTCCTTCGTTAAGAAGAACCGCAGCTACTCGGATGAGATATGAGATGAAGCTGACCTTCGCCGCGCCAACAAAACCTTCTACGATGCCGTACGATGCCGCTGTGGTGCGCCAAATGGTGCGCCAAATCGATGTGCCTTCATGGCAAGACCCTCAAGTTCTTCGTGGTTCCGTCACCGTCAACGAGGATTGAGGATTCCTCCGTTCAGGTTCTGGGAAATACCAGTCACAGCTTAGCTCCTGCCATTGCCGTGGAGGTCGCCGAAGAAGCGTTAGTCAAGGCTGCCGAATGGCTGCCGAATAGACGTAATCACCATTTTCTCGTGTTTTTCGCTATCAAA

Full Affymetrix probeset data:

Annotations for 1637737_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720