FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637738_at:

>probe:Drosophila_2:1637738_at:510:311; Interrogation_Position=104; Antisense; GCCACGAAATGGTTTTGCTAGACAA
>probe:Drosophila_2:1637738_at:86:397; Interrogation_Position=124; Antisense; GACAATTCGAACTTTATCCTGCGCC
>probe:Drosophila_2:1637738_at:264:385; Interrogation_Position=132; Antisense; GAACTTTATCCTGCGCCTGGAGAAG
>probe:Drosophila_2:1637738_at:632:275; Interrogation_Position=186; Antisense; CTTCACGCTGACGTTCAAGCGATAT
>probe:Drosophila_2:1637738_at:349:441; Interrogation_Position=211; Antisense; GATGGCAACGATAAGCCCGTGCCGA
>probe:Drosophila_2:1637738_at:493:233; Interrogation_Position=24; Antisense; AATCCGATATTATTGCAGGGCTTTT
>probe:Drosophila_2:1637738_at:361:205; Interrogation_Position=259; Antisense; AAGCCGGAGACCTACATGTGCCTGA
>probe:Drosophila_2:1637738_at:261:241; Interrogation_Position=309; Antisense; AATTTCCACCGTTGTCCGGCAGGAG
>probe:Drosophila_2:1637738_at:205:63; Interrogation_Position=335; Antisense; ATGTGCCCGCCATGATGAGCATGTA
>probe:Drosophila_2:1637738_at:381:57; Interrogation_Position=349; Antisense; ATGAGCATGTACTCGCAGTTCATGA
>probe:Drosophila_2:1637738_at:411:265; Interrogation_Position=39; Antisense; CAGGGCTTTTAGCAAGGGATTGTCT
>probe:Drosophila_2:1637738_at:202:687; Interrogation_Position=470; Antisense; TTGACTGTTTACTGGTCGTTTGTTT
>probe:Drosophila_2:1637738_at:487:661; Interrogation_Position=63; Antisense; TAAAGCCTTGTGTCACTTTTCCCGT
>probe:Drosophila_2:1637738_at:472:479; Interrogation_Position=86; Antisense; GTTTCTCCTGTTTTATTTGCCACGA

Paste this into a BLAST search page for me
GCCACGAAATGGTTTTGCTAGACAAGACAATTCGAACTTTATCCTGCGCCGAACTTTATCCTGCGCCTGGAGAAGCTTCACGCTGACGTTCAAGCGATATGATGGCAACGATAAGCCCGTGCCGAAATCCGATATTATTGCAGGGCTTTTAAGCCGGAGACCTACATGTGCCTGAAATTTCCACCGTTGTCCGGCAGGAGATGTGCCCGCCATGATGAGCATGTAATGAGCATGTACTCGCAGTTCATGACAGGGCTTTTAGCAAGGGATTGTCTTTGACTGTTTACTGGTCGTTTGTTTTAAAGCCTTGTGTCACTTTTCCCGTGTTTCTCCTGTTTTATTTGCCACGA

Full Affymetrix probeset data:

Annotations for 1637738_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720