Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637739_at:

>probe:Drosophila_2:1637739_at:399:483; Interrogation_Position=2006; Antisense; GTATACAACACTCAGACACACCTGT
>probe:Drosophila_2:1637739_at:38:41; Interrogation_Position=2044; Antisense; ATCTGGCGGAGATCTGCATGATGTT
>probe:Drosophila_2:1637739_at:485:431; Interrogation_Position=2079; Antisense; GAGTGGCGGATAGCATCTTCCGTGT
>probe:Drosophila_2:1637739_at:366:77; Interrogation_Position=2106; Antisense; AGGAGGAGGGATTCCGCATTCCGCA
>probe:Drosophila_2:1637739_at:247:119; Interrogation_Position=2130; Antisense; AGCTGCTTTCCCATGTGACGTGACA
>probe:Drosophila_2:1637739_at:588:385; Interrogation_Position=2163; Antisense; GAAAATTTGACGCACGCACCCGTAA
>probe:Drosophila_2:1637739_at:186:45; Interrogation_Position=2178; Antisense; GCACCCGTAACCACCAAGTAGAAAT
>probe:Drosophila_2:1637739_at:410:57; Interrogation_Position=2201; Antisense; ATGAGTACTCCAGATGCAAATCCCC
>probe:Drosophila_2:1637739_at:142:205; Interrogation_Position=2234; Antisense; AAGCCAGTGGGATCCGAGGCATCTG
>probe:Drosophila_2:1637739_at:701:61; Interrogation_Position=2272; Antisense; ATGTGCTGGAGCGTCTGTGATAACA
>probe:Drosophila_2:1637739_at:694:383; Interrogation_Position=2342; Antisense; GAACTCGTGAATTATGTGTGCTCCT
>probe:Drosophila_2:1637739_at:376:517; Interrogation_Position=2357; Antisense; GTGTGCTCCTCAATTTTCGTAATGT
>probe:Drosophila_2:1637739_at:114:1; Interrogation_Position=2443; Antisense; ACCCCGGACTAATCCTATATCTTAG
>probe:Drosophila_2:1637739_at:313:643; Interrogation_Position=2462; Antisense; TCTTAGACCTTTGTGACCGTAACTC

Paste this into a BLAST search page for me
GTATACAACACTCAGACACACCTGTATCTGGCGGAGATCTGCATGATGTTGAGTGGCGGATAGCATCTTCCGTGTAGGAGGAGGGATTCCGCATTCCGCAAGCTGCTTTCCCATGTGACGTGACAGAAAATTTGACGCACGCACCCGTAAGCACCCGTAACCACCAAGTAGAAATATGAGTACTCCAGATGCAAATCCCCAAGCCAGTGGGATCCGAGGCATCTGATGTGCTGGAGCGTCTGTGATAACAGAACTCGTGAATTATGTGTGCTCCTGTGTGCTCCTCAATTTTCGTAATGTACCCCGGACTAATCCTATATCTTAGTCTTAGACCTTTGTGACCGTAACTC

Full Affymetrix probeset data:

Annotations for 1637739_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime