FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637740_at:

>probe:Drosophila_2:1637740_at:360:61; Interrogation_Position=244; Antisense; ATGTAAACATCTTACTGCTTCTCCC
>probe:Drosophila_2:1637740_at:313:633; Interrogation_Position=265; Antisense; TCCCCGCATTTTTTCAGATCTATCA
>probe:Drosophila_2:1637740_at:395:97; Interrogation_Position=280; Antisense; AGATCTATCACATCTCCTTGCTGGT
>probe:Drosophila_2:1637740_at:392:275; Interrogation_Position=296; Antisense; CTTGCTGGTGGCGATTGTTCTCATG
>probe:Drosophila_2:1637740_at:662:711; Interrogation_Position=313; Antisense; TTCTCATGTGGAACTGCTACCTTCA
>probe:Drosophila_2:1637740_at:511:581; Interrogation_Position=346; Antisense; TGGCTGCTTTCCACCTGAAGATGGT
>probe:Drosophila_2:1637740_at:44:585; Interrogation_Position=372; Antisense; TGGCACTTGTGGTGGAGCGACCTAT
>probe:Drosophila_2:1637740_at:370:683; Interrogation_Position=394; Antisense; TATGCTGGAGCTACTACGCTTCTCT
>probe:Drosophila_2:1637740_at:689:699; Interrogation_Position=424; Antisense; TTTTCGGATTCCTGTTGACCATGCT
>probe:Drosophila_2:1637740_at:611:413; Interrogation_Position=440; Antisense; GACCATGCTGCACTTTAGTCTGATT
>probe:Drosophila_2:1637740_at:488:43; Interrogation_Position=492; Antisense; ATCGACGGAGATCCCAAACCTCGGA
>probe:Drosophila_2:1637740_at:189:661; Interrogation_Position=618; Antisense; TAAACGACGGAGCACAGGTTCAGCC
>probe:Drosophila_2:1637740_at:7:539; Interrogation_Position=634; Antisense; GGTTCAGCCGCCTTTAAGTGGGTCA
>probe:Drosophila_2:1637740_at:28:659; Interrogation_Position=696; Antisense; TACACTGGGTCGGTGGTTCAACTAA

Paste this into a BLAST search page for me
ATGTAAACATCTTACTGCTTCTCCCTCCCCGCATTTTTTCAGATCTATCAAGATCTATCACATCTCCTTGCTGGTCTTGCTGGTGGCGATTGTTCTCATGTTCTCATGTGGAACTGCTACCTTCATGGCTGCTTTCCACCTGAAGATGGTTGGCACTTGTGGTGGAGCGACCTATTATGCTGGAGCTACTACGCTTCTCTTTTTCGGATTCCTGTTGACCATGCTGACCATGCTGCACTTTAGTCTGATTATCGACGGAGATCCCAAACCTCGGATAAACGACGGAGCACAGGTTCAGCCGGTTCAGCCGCCTTTAAGTGGGTCATACACTGGGTCGGTGGTTCAACTAA

Full Affymetrix probeset data:

Annotations for 1637740_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720