Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637741_a_at:

>probe:Drosophila_2:1637741_a_at:349:97; Interrogation_Position=1023; Antisense; AGATCCAGTTTCTCAAGTCCGTGTG
>probe:Drosophila_2:1637741_a_at:681:303; Interrogation_Position=1041; Antisense; CCGTGTGGGCAGTGGTCAAGACCTT
>probe:Drosophila_2:1637741_a_at:272:329; Interrogation_Position=1085; Antisense; GCGGGTCTCGAGGAGTTCTGTCAAT
>probe:Drosophila_2:1637741_a_at:634:29; Interrogation_Position=1114; Antisense; ATACAGCGCCCTACTGATTGAGATT
>probe:Drosophila_2:1637741_a_at:660:531; Interrogation_Position=672; Antisense; GGGTGGACGCACTGTTCAACATGCT
>probe:Drosophila_2:1637741_a_at:255:101; Interrogation_Position=720; Antisense; AGAGCTTCCATGAGCGGCGCAAGTC
>probe:Drosophila_2:1637741_a_at:100:577; Interrogation_Position=735; Antisense; GGCGCAAGTCCACCGATCTGAATAT
>probe:Drosophila_2:1637741_a_at:556:365; Interrogation_Position=790; Antisense; GAATCAGCGCACTGTCTCAATGACT
>probe:Drosophila_2:1637741_a_at:370:231; Interrogation_Position=808; Antisense; AATGACTGTGGCACTTCAGGCGAAC
>probe:Drosophila_2:1637741_a_at:385:647; Interrogation_Position=823; Antisense; TCAGGCGAACGTTGGTCCCAAAACT
>probe:Drosophila_2:1637741_a_at:554:423; Interrogation_Position=860; Antisense; GAGACACAGACCATGCGCGAGTGCA
>probe:Drosophila_2:1637741_a_at:475:287; Interrogation_Position=892; Antisense; CGGCCAACTGTACTCGATCGATGTG
>probe:Drosophila_2:1637741_a_at:169:415; Interrogation_Position=919; Antisense; GAGCGTTAACGCAGATATCCCCTAC
>probe:Drosophila_2:1637741_a_at:624:111; Interrogation_Position=996; Antisense; AGCACACGGACGTTTTGGTCTTTGC

Paste this into a BLAST search page for me
AGATCCAGTTTCTCAAGTCCGTGTGCCGTGTGGGCAGTGGTCAAGACCTTGCGGGTCTCGAGGAGTTCTGTCAATATACAGCGCCCTACTGATTGAGATTGGGTGGACGCACTGTTCAACATGCTAGAGCTTCCATGAGCGGCGCAAGTCGGCGCAAGTCCACCGATCTGAATATGAATCAGCGCACTGTCTCAATGACTAATGACTGTGGCACTTCAGGCGAACTCAGGCGAACGTTGGTCCCAAAACTGAGACACAGACCATGCGCGAGTGCACGGCCAACTGTACTCGATCGATGTGGAGCGTTAACGCAGATATCCCCTACAGCACACGGACGTTTTGGTCTTTGC

Full Affymetrix probeset data:

Annotations for 1637741_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime