FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637742_at:

>probe:Drosophila_2:1637742_at:516:377; Interrogation_Position=111; Antisense; GAAGCTTTATGAGGCTATCTCCAAA
>probe:Drosophila_2:1637742_at:502:69; Interrogation_Position=13; Antisense; ATGGCCAGCCTCAAGTGGTTAGCTA
>probe:Drosophila_2:1637742_at:139:143; Interrogation_Position=136; Antisense; ACTGGATCTACGATCAAATCCGGAT
>probe:Drosophila_2:1637742_at:364:47; Interrogation_Position=153; Antisense; ATCCGGATCGGCAAGCTTACAGAGT
>probe:Drosophila_2:1637742_at:79:101; Interrogation_Position=173; Antisense; AGAGTCTTGATGATGCCGTGCGTAA
>probe:Drosophila_2:1637742_at:613:181; Interrogation_Position=212; Antisense; AAAAGGGCGCGGCTAAGTCGCTCTT
>probe:Drosophila_2:1637742_at:258:503; Interrogation_Position=228; Antisense; GTCGCTCTTGGATCTAGTAAGCAAT
>probe:Drosophila_2:1637742_at:267:111; Interrogation_Position=247; Antisense; AGCAATCGTATCTTAAAACCTGAAA
>probe:Drosophila_2:1637742_at:613:517; Interrogation_Position=27; Antisense; GTGGTTAGCTATTCTACAACTCTTA
>probe:Drosophila_2:1637742_at:408:343; Interrogation_Position=283; Antisense; GCTTCCCTCTCATCATGTGGTGAAG
>probe:Drosophila_2:1637742_at:87:539; Interrogation_Position=333; Antisense; GGTACTGGCCGCAGAATCCACACAG
>probe:Drosophila_2:1637742_at:324:257; Interrogation_Position=353; Antisense; CACAGCAACCAAACACCATAACTTA
>probe:Drosophila_2:1637742_at:220:655; Interrogation_Position=50; Antisense; TAATTATTTTCGGTGCTCTTGGGCA
>probe:Drosophila_2:1637742_at:165:275; Interrogation_Position=67; Antisense; CTTGGGCACGCCGAAGTTGATGAAA

Paste this into a BLAST search page for me
GAAGCTTTATGAGGCTATCTCCAAAATGGCCAGCCTCAAGTGGTTAGCTAACTGGATCTACGATCAAATCCGGATATCCGGATCGGCAAGCTTACAGAGTAGAGTCTTGATGATGCCGTGCGTAAAAAAGGGCGCGGCTAAGTCGCTCTTGTCGCTCTTGGATCTAGTAAGCAATAGCAATCGTATCTTAAAACCTGAAAGTGGTTAGCTATTCTACAACTCTTAGCTTCCCTCTCATCATGTGGTGAAGGGTACTGGCCGCAGAATCCACACAGCACAGCAACCAAACACCATAACTTATAATTATTTTCGGTGCTCTTGGGCACTTGGGCACGCCGAAGTTGATGAAA

Full Affymetrix probeset data:

Annotations for 1637742_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720