Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637743_at:

>probe:Drosophila_2:1637743_at:588:407; Interrogation_Position=3764; Antisense; GACGGAATCGCATTTACGATGGCCA
>probe:Drosophila_2:1637743_at:256:133; Interrogation_Position=3820; Antisense; ACCGCCACGCTTGAGCATAATCAGA
>probe:Drosophila_2:1637743_at:405:385; Interrogation_Position=3852; Antisense; GAACAAGTTTGGTGGGCTGTGCCTA
>probe:Drosophila_2:1637743_at:356:585; Interrogation_Position=3935; Antisense; TGGAAAAGGCCGTATCCAGCGGGCA
>probe:Drosophila_2:1637743_at:646:121; Interrogation_Position=3952; Antisense; AGCGGGCAGTGCCTGTACAAGATTA
>probe:Drosophila_2:1637743_at:104:215; Interrogation_Position=3970; Antisense; AAGATTAGCAGCTACACCTCCTTTC
>probe:Drosophila_2:1637743_at:534:131; Interrogation_Position=4037; Antisense; ACCGCAATGCCATATGCGTCAATTG
>probe:Drosophila_2:1637743_at:94:271; Interrogation_Position=4075; Antisense; CATGCTGGTCATGACGTCGAGTTTA
>probe:Drosophila_2:1637743_at:70:683; Interrogation_Position=4098; Antisense; TATACGACACGATCGCTTCTTTTGC
>probe:Drosophila_2:1637743_at:597:583; Interrogation_Position=4134; Antisense; TGGCACCCTGTCCAATCAGTGTCAA
>probe:Drosophila_2:1637743_at:474:81; Interrogation_Position=4163; Antisense; AGGGCGAACCCACTCAGGACACGGA
>probe:Drosophila_2:1637743_at:314:197; Interrogation_Position=4252; Antisense; AACGGCAGCTAATCCACTATAGATA
>probe:Drosophila_2:1637743_at:107:711; Interrogation_Position=4289; Antisense; TTAAGGCCAATCTCTCAAATCTCTC
>probe:Drosophila_2:1637743_at:716:257; Interrogation_Position=4315; Antisense; CACATCTCACGCGTTGCTGTAAATA

Paste this into a BLAST search page for me
GACGGAATCGCATTTACGATGGCCAACCGCCACGCTTGAGCATAATCAGAGAACAAGTTTGGTGGGCTGTGCCTATGGAAAAGGCCGTATCCAGCGGGCAAGCGGGCAGTGCCTGTACAAGATTAAAGATTAGCAGCTACACCTCCTTTCACCGCAATGCCATATGCGTCAATTGCATGCTGGTCATGACGTCGAGTTTATATACGACACGATCGCTTCTTTTGCTGGCACCCTGTCCAATCAGTGTCAAAGGGCGAACCCACTCAGGACACGGAAACGGCAGCTAATCCACTATAGATATTAAGGCCAATCTCTCAAATCTCTCCACATCTCACGCGTTGCTGTAAATA

Full Affymetrix probeset data:

Annotations for 1637743_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime