Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637744_at:

>probe:Drosophila_2:1637744_at:79:603; Interrogation_Position=1756; Antisense; TGTTCTTATCTTTCTTCTTATCCGT
>probe:Drosophila_2:1637744_at:367:703; Interrogation_Position=1785; Antisense; TTATCCTTCTTATCCTTTTTCATCT
>probe:Drosophila_2:1637744_at:575:37; Interrogation_Position=1806; Antisense; ATCTTCTTGAGCATGTCTTTTCTCG
>probe:Drosophila_2:1637744_at:198:305; Interrogation_Position=1840; Antisense; CCTTTTTTATGGCACTGGGACAGAC
>probe:Drosophila_2:1637744_at:19:559; Interrogation_Position=1857; Antisense; GGACAGACGTGGTTCTCACCATGAA
>probe:Drosophila_2:1637744_at:494:307; Interrogation_Position=1875; Antisense; CCATGAATTTTGACCCACTGACGAC
>probe:Drosophila_2:1637744_at:448:635; Interrogation_Position=1938; Antisense; TCGCACTCGCGAGGTCGATATGGTC
>probe:Drosophila_2:1637744_at:500:23; Interrogation_Position=1955; Antisense; ATATGGTCGCTTGGCCAGCTTAGGC
>probe:Drosophila_2:1637744_at:169:263; Interrogation_Position=1970; Antisense; CAGCTTAGGCTGCTTACAATCCGAC
>probe:Drosophila_2:1637744_at:419:129; Interrogation_Position=1993; Antisense; ACCAGCAGGGCATCGGTGCACACAA
>probe:Drosophila_2:1637744_at:426:135; Interrogation_Position=2076; Antisense; ACGCATCGTGCCAACGGAGCGAAAT
>probe:Drosophila_2:1637744_at:255:401; Interrogation_Position=2104; Antisense; GACATGGTCCTGTGGCTGTGGCACT
>probe:Drosophila_2:1637744_at:460:629; Interrogation_Position=2181; Antisense; TCCAGCTTGTCGTAGGCGCAGATTA
>probe:Drosophila_2:1637744_at:256:351; Interrogation_Position=2198; Antisense; GCAGATTATCTTCTTGCGGATCATG

Paste this into a BLAST search page for me
TGTTCTTATCTTTCTTCTTATCCGTTTATCCTTCTTATCCTTTTTCATCTATCTTCTTGAGCATGTCTTTTCTCGCCTTTTTTATGGCACTGGGACAGACGGACAGACGTGGTTCTCACCATGAACCATGAATTTTGACCCACTGACGACTCGCACTCGCGAGGTCGATATGGTCATATGGTCGCTTGGCCAGCTTAGGCCAGCTTAGGCTGCTTACAATCCGACACCAGCAGGGCATCGGTGCACACAAACGCATCGTGCCAACGGAGCGAAATGACATGGTCCTGTGGCTGTGGCACTTCCAGCTTGTCGTAGGCGCAGATTAGCAGATTATCTTCTTGCGGATCATG

Full Affymetrix probeset data:

Annotations for 1637744_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime