FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637746_at:

>probe:Drosophila_2:1637746_at:502:27; Interrogation_Position=281; Antisense; ATACATCTGGAAATCGTGGCTCATT
>probe:Drosophila_2:1637746_at:325:291; Interrogation_Position=295; Antisense; CGTGGCTCATTTGGCTTGCGACAAA
>probe:Drosophila_2:1637746_at:94:397; Interrogation_Position=314; Antisense; GACAAATGAGGAAGCGCGTTAAGTT
>probe:Drosophila_2:1637746_at:606:473; Interrogation_Position=331; Antisense; GTTAAGTTGGAGGACACCGACGAGA
>probe:Drosophila_2:1637746_at:155:399; Interrogation_Position=343; Antisense; GACACCGACGAGAAGTCTTACAAAA
>probe:Drosophila_2:1637746_at:337:95; Interrogation_Position=367; Antisense; AGATCTCCCAAAATGAAGGTCATAT
>probe:Drosophila_2:1637746_at:158:653; Interrogation_Position=391; Antisense; TCAATGAAGCAGTCACCTCTGAAGG
>probe:Drosophila_2:1637746_at:103:615; Interrogation_Position=410; Antisense; TGAAGGGACCGGCTCCAATCATATT
>probe:Drosophila_2:1637746_at:148:413; Interrogation_Position=416; Antisense; GACCGGCTCCAATCATATTGCGTAA
>probe:Drosophila_2:1637746_at:320:239; Interrogation_Position=450; Antisense; AATCTACGTAGCTAGTGTTTGGACT
>probe:Drosophila_2:1637746_at:509:599; Interrogation_Position=465; Antisense; TGTTTGGACTAGTGCTGGCTACGTC
>probe:Drosophila_2:1637746_at:188:571; Interrogation_Position=481; Antisense; GGCTACGTCTTGGTGATCCGGGAAC
>probe:Drosophila_2:1637746_at:334:47; Interrogation_Position=496; Antisense; ATCCGGGAACCGTCTGCAGTTGAAA
>probe:Drosophila_2:1637746_at:215:25; Interrogation_Position=527; Antisense; ATAGCAGTTCGGTCAGTTGGCTTGG

Paste this into a BLAST search page for me
ATACATCTGGAAATCGTGGCTCATTCGTGGCTCATTTGGCTTGCGACAAAGACAAATGAGGAAGCGCGTTAAGTTGTTAAGTTGGAGGACACCGACGAGAGACACCGACGAGAAGTCTTACAAAAAGATCTCCCAAAATGAAGGTCATATTCAATGAAGCAGTCACCTCTGAAGGTGAAGGGACCGGCTCCAATCATATTGACCGGCTCCAATCATATTGCGTAAAATCTACGTAGCTAGTGTTTGGACTTGTTTGGACTAGTGCTGGCTACGTCGGCTACGTCTTGGTGATCCGGGAACATCCGGGAACCGTCTGCAGTTGAAAATAGCAGTTCGGTCAGTTGGCTTGG

Full Affymetrix probeset data:

Annotations for 1637746_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720