FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637749_at:

>probe:Drosophila_2:1637749_at:272:155; Interrogation_Position=3786; Antisense; ACAGTTCAACTTTCAGATCAGTGCG
>probe:Drosophila_2:1637749_at:395:453; Interrogation_Position=3801; Antisense; GATCAGTGCGAAATGCTCCTAAGTT
>probe:Drosophila_2:1637749_at:373:43; Interrogation_Position=3813; Antisense; ATGCTCCTAAGTTAAGTTCTTCCAA
>probe:Drosophila_2:1637749_at:720:535; Interrogation_Position=3866; Antisense; GGTAAATTTGCAATTCGAACTAACT
>probe:Drosophila_2:1637749_at:674:29; Interrogation_Position=3904; Antisense; ATACACCAACATAGGCCACACACTA
>probe:Drosophila_2:1637749_at:207:709; Interrogation_Position=3956; Antisense; TTGTAGCCTGAGTTTTCGAGTCGTT
>probe:Drosophila_2:1637749_at:499:637; Interrogation_Position=3971; Antisense; TCGAGTCGTTGAATTGTTGTCTGTT
>probe:Drosophila_2:1637749_at:288:461; Interrogation_Position=3986; Antisense; GTTGTCTGTTATTACGTTACGTTGT
>probe:Drosophila_2:1637749_at:498:291; Interrogation_Position=4000; Antisense; CGTTACGTTGTGAATGGGATATAGC
>probe:Drosophila_2:1637749_at:224:27; Interrogation_Position=4020; Antisense; ATAGCATACATATAGGGTCCCCGGA
>probe:Drosophila_2:1637749_at:556:23; Interrogation_Position=4031; Antisense; ATAGGGTCCCCGGAGATCTCTCTAC
>probe:Drosophila_2:1637749_at:315:551; Interrogation_Position=4042; Antisense; GGAGATCTCTCTACCAATAAAGCAT
>probe:Drosophila_2:1637749_at:295:391; Interrogation_Position=4205; Antisense; GAAACGTAGGCTAAGCTCTCAGAAA
>probe:Drosophila_2:1637749_at:503:537; Interrogation_Position=4301; Antisense; GGTACAGAATAGTATGCGTCAGCAT

Paste this into a BLAST search page for me
ACAGTTCAACTTTCAGATCAGTGCGGATCAGTGCGAAATGCTCCTAAGTTATGCTCCTAAGTTAAGTTCTTCCAAGGTAAATTTGCAATTCGAACTAACTATACACCAACATAGGCCACACACTATTGTAGCCTGAGTTTTCGAGTCGTTTCGAGTCGTTGAATTGTTGTCTGTTGTTGTCTGTTATTACGTTACGTTGTCGTTACGTTGTGAATGGGATATAGCATAGCATACATATAGGGTCCCCGGAATAGGGTCCCCGGAGATCTCTCTACGGAGATCTCTCTACCAATAAAGCATGAAACGTAGGCTAAGCTCTCAGAAAGGTACAGAATAGTATGCGTCAGCAT

Full Affymetrix probeset data:

Annotations for 1637749_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720