FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637750_at:

>probe:Drosophila_2:1637750_at:342:545; Interrogation_Position=2102; Antisense; GGATCGCTTCTTTTCCGTTCGCAAT
>probe:Drosophila_2:1637750_at:386:471; Interrogation_Position=2118; Antisense; GTTCGCAATTCTGATCGCGTTTATT
>probe:Drosophila_2:1637750_at:409:45; Interrogation_Position=2131; Antisense; ATCGCGTTTATTCGAACCGCTCAAA
>probe:Drosophila_2:1637750_at:256:11; Interrogation_Position=2140; Antisense; ATTCGAACCGCTCAAAAGTGTCATG
>probe:Drosophila_2:1637750_at:405:219; Interrogation_Position=2155; Antisense; AAGTGTCATGCGTTTTCCCGAAAGT
>probe:Drosophila_2:1637750_at:227:723; Interrogation_Position=2214; Antisense; TTGAGCAACTTCAAGCGATTTTTGA
>probe:Drosophila_2:1637750_at:720:607; Interrogation_Position=2236; Antisense; TGAGATCAGAATTTGCTACGCGAAA
>probe:Drosophila_2:1637750_at:23:693; Interrogation_Position=2247; Antisense; TTTGCTACGCGAAACGAGTTGAAAA
>probe:Drosophila_2:1637750_at:180:475; Interrogation_Position=2332; Antisense; GTTAAACGTAGCCAACATTTACATT
>probe:Drosophila_2:1637750_at:482:149; Interrogation_Position=2346; Antisense; ACATTTACATTTAAGTCTCCAGTTG
>probe:Drosophila_2:1637750_at:722:87; Interrogation_Position=2359; Antisense; AGTCTCCAGTTGTAAACTATACTTA
>probe:Drosophila_2:1637750_at:535:165; Interrogation_Position=2447; Antisense; AAATCGGTTCAGAGTGGCAAAATCA
>probe:Drosophila_2:1637750_at:174:293; Interrogation_Position=2517; Antisense; CGAGCGGTGCAATTTTTTATGTTTT
>probe:Drosophila_2:1637750_at:291:177; Interrogation_Position=2542; Antisense; AAACGCAGATCGAAGTGCATAGCAT

Paste this into a BLAST search page for me
GGATCGCTTCTTTTCCGTTCGCAATGTTCGCAATTCTGATCGCGTTTATTATCGCGTTTATTCGAACCGCTCAAAATTCGAACCGCTCAAAAGTGTCATGAAGTGTCATGCGTTTTCCCGAAAGTTTGAGCAACTTCAAGCGATTTTTGATGAGATCAGAATTTGCTACGCGAAATTTGCTACGCGAAACGAGTTGAAAAGTTAAACGTAGCCAACATTTACATTACATTTACATTTAAGTCTCCAGTTGAGTCTCCAGTTGTAAACTATACTTAAAATCGGTTCAGAGTGGCAAAATCACGAGCGGTGCAATTTTTTATGTTTTAAACGCAGATCGAAGTGCATAGCAT

Full Affymetrix probeset data:

Annotations for 1637750_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720