FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637751_at:

>probe:Drosophila_2:1637751_at:322:623; Interrogation_Position=177; Antisense; TGCGGCTTTAGTACGTGGTCATGCT
>probe:Drosophila_2:1637751_at:493:435; Interrogation_Position=22; Antisense; GAGGTGCAGTCATCCAAAATCGTCA
>probe:Drosophila_2:1637751_at:437:35; Interrogation_Position=250; Antisense; ATCAGCTCAGGTGTACTCCAGCTAG
>probe:Drosophila_2:1637751_at:672:143; Interrogation_Position=264; Antisense; ACTCCAGCTAGCTCCGGATACGGAA
>probe:Drosophila_2:1637751_at:726:115; Interrogation_Position=313; Antisense; AGCTCGTACTCCATGTCACTGGGAA
>probe:Drosophila_2:1637751_at:625:581; Interrogation_Position=343; Antisense; TGGCCGCATTACTATGTGGACACCT
>probe:Drosophila_2:1637751_at:140:181; Interrogation_Position=37; Antisense; AAAATCGTCACCGATGGGCGTTCAT
>probe:Drosophila_2:1637751_at:41:45; Interrogation_Position=375; Antisense; ATCGCATTTGCCACATTCAGTGATT
>probe:Drosophila_2:1637751_at:578:713; Interrogation_Position=390; Antisense; TTCAGTGATTCCATCGATTCCATCG
>probe:Drosophila_2:1637751_at:408:381; Interrogation_Position=439; Antisense; GAACCCCGCATCGTGGTCAATGATA
>probe:Drosophila_2:1637751_at:493:141; Interrogation_Position=484; Antisense; AAATTGCCCCAGCATCAAGTTGTCC
>probe:Drosophila_2:1637751_at:237:63; Interrogation_Position=50; Antisense; ATGGGCGTTCATCCAAGACCAAGAA
>probe:Drosophila_2:1637751_at:404:471; Interrogation_Position=80; Antisense; GTTCGCCGGCGCATATAAAAGCTGT
>probe:Drosophila_2:1637751_at:152:663; Interrogation_Position=95; Antisense; TAAAAGCTGTGATCCCCTCGAAGAA

Paste this into a BLAST search page for me
TGCGGCTTTAGTACGTGGTCATGCTGAGGTGCAGTCATCCAAAATCGTCAATCAGCTCAGGTGTACTCCAGCTAGACTCCAGCTAGCTCCGGATACGGAAAGCTCGTACTCCATGTCACTGGGAATGGCCGCATTACTATGTGGACACCTAAAATCGTCACCGATGGGCGTTCATATCGCATTTGCCACATTCAGTGATTTTCAGTGATTCCATCGATTCCATCGGAACCCCGCATCGTGGTCAATGATAAAATTGCCCCAGCATCAAGTTGTCCATGGGCGTTCATCCAAGACCAAGAAGTTCGCCGGCGCATATAAAAGCTGTTAAAAGCTGTGATCCCCTCGAAGAA

Full Affymetrix probeset data:

Annotations for 1637751_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720