Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637752_a_at:

>probe:Drosophila_2:1637752_a_at:19:319; Interrogation_Position=1000; Antisense; GCCGGAGCTGCCCAACAAATAGAAT
>probe:Drosophila_2:1637752_a_at:524:7; Interrogation_Position=1067; Antisense; ATTGCAGTTCGTAAACCAGGCACAA
>probe:Drosophila_2:1637752_a_at:695:163; Interrogation_Position=1108; Antisense; AAATCTGATCGGTGGGCACGTGGAT
>probe:Drosophila_2:1637752_a_at:224:357; Interrogation_Position=1167; Antisense; GCAAAGCTGGCGAGGATTCCATTAA
>probe:Drosophila_2:1637752_a_at:1:709; Interrogation_Position=771; Antisense; TTACACGAGGCTTCCGGGCGGTTGA
>probe:Drosophila_2:1637752_a_at:48:681; Interrogation_Position=792; Antisense; TTGAGAAGGCGCTGTCCACTTCGGC
>probe:Drosophila_2:1637752_a_at:189:259; Interrogation_Position=808; Antisense; CACTTCGGCCGGCAAATATTGCGTG
>probe:Drosophila_2:1637752_a_at:711:7; Interrogation_Position=825; Antisense; ATTGCGTGGGCGATGAGATCTCCAT
>probe:Drosophila_2:1637752_a_at:395:57; Interrogation_Position=837; Antisense; ATGAGATCTCCATGGCGGACTGCTG
>probe:Drosophila_2:1637752_a_at:548:487; Interrogation_Position=866; Antisense; GTACCTCAGGTGTTCAATGCCCGAA
>probe:Drosophila_2:1637752_a_at:351:293; Interrogation_Position=887; Antisense; CGAAGATTCCACGTCGACTTGCGAC
>probe:Drosophila_2:1637752_a_at:337:723; Interrogation_Position=905; Antisense; TTGCGACCGTATCCCATAATTCTGC
>probe:Drosophila_2:1637752_a_at:619:653; Interrogation_Position=921; Antisense; TAATTCTGCGCATCGATCGCGAACT
>probe:Drosophila_2:1637752_a_at:110:141; Interrogation_Position=943; Antisense; ACTGGAGAGCAATCCGGCATTCCGG

Paste this into a BLAST search page for me
GCCGGAGCTGCCCAACAAATAGAATATTGCAGTTCGTAAACCAGGCACAAAAATCTGATCGGTGGGCACGTGGATGCAAAGCTGGCGAGGATTCCATTAATTACACGAGGCTTCCGGGCGGTTGATTGAGAAGGCGCTGTCCACTTCGGCCACTTCGGCCGGCAAATATTGCGTGATTGCGTGGGCGATGAGATCTCCATATGAGATCTCCATGGCGGACTGCTGGTACCTCAGGTGTTCAATGCCCGAACGAAGATTCCACGTCGACTTGCGACTTGCGACCGTATCCCATAATTCTGCTAATTCTGCGCATCGATCGCGAACTACTGGAGAGCAATCCGGCATTCCGG

Full Affymetrix probeset data:

Annotations for 1637752_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime