Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637753_at:

>probe:Drosophila_2:1637753_at:206:361; Interrogation_Position=2808; Antisense; GCAAGTGCAGCGATCGGTACTTCCC
>probe:Drosophila_2:1637753_at:359:527; Interrogation_Position=2869; Antisense; GGGACTGCCCAGTGCCAAGGAGAAA
>probe:Drosophila_2:1637753_at:689:555; Interrogation_Position=2975; Antisense; GGACTGCAGAGCCTCAGTGACTTCG
>probe:Drosophila_2:1637753_at:479:511; Interrogation_Position=3020; Antisense; GTGACCTACCTGTACAGTGAGGGCC
>probe:Drosophila_2:1637753_at:223:93; Interrogation_Position=3060; Antisense; AGTTCAGCAACTTCGTCGACTGCAA
>probe:Drosophila_2:1637753_at:236:527; Interrogation_Position=3103; Antisense; GGGAGCGCTGATTTAGATTACGATT
>probe:Drosophila_2:1637753_at:618:341; Interrogation_Position=3143; Antisense; GCTTGTGTACTATAGATACCCCAAT
>probe:Drosophila_2:1637753_at:639:379; Interrogation_Position=3187; Antisense; GAACCCTAATCCCAGCCAGATGTAC
>probe:Drosophila_2:1637753_at:278:99; Interrogation_Position=3204; Antisense; AGATGTACTTGGACCGCGCGGACGT
>probe:Drosophila_2:1637753_at:148:557; Interrogation_Position=3223; Antisense; GGACGTTGTCGTTGTGATCATCATT
>probe:Drosophila_2:1637753_at:697:465; Interrogation_Position=3250; Antisense; GATTGGATACCATTGTCGTCAGAAT
>probe:Drosophila_2:1637753_at:472:661; Interrogation_Position=3302; Antisense; TAACTCCCCTGAATGTTGAATGCAA
>probe:Drosophila_2:1637753_at:26:199; Interrogation_Position=3325; Antisense; AACCCAAATGACAGCTTGCGTGCAG
>probe:Drosophila_2:1637753_at:651:327; Interrogation_Position=3342; Antisense; GCGTGCAGGCATTCTTAGTACCACT

Paste this into a BLAST search page for me
GCAAGTGCAGCGATCGGTACTTCCCGGGACTGCCCAGTGCCAAGGAGAAAGGACTGCAGAGCCTCAGTGACTTCGGTGACCTACCTGTACAGTGAGGGCCAGTTCAGCAACTTCGTCGACTGCAAGGGAGCGCTGATTTAGATTACGATTGCTTGTGTACTATAGATACCCCAATGAACCCTAATCCCAGCCAGATGTACAGATGTACTTGGACCGCGCGGACGTGGACGTTGTCGTTGTGATCATCATTGATTGGATACCATTGTCGTCAGAATTAACTCCCCTGAATGTTGAATGCAAAACCCAAATGACAGCTTGCGTGCAGGCGTGCAGGCATTCTTAGTACCACT

Full Affymetrix probeset data:

Annotations for 1637753_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime