FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637754_at:

>probe:Drosophila_2:1637754_at:242:37; Interrogation_Position=226; Antisense; ATCATGTGCTTTTTTGCTGTCCACT
>probe:Drosophila_2:1637754_at:29:3; Interrogation_Position=255; Antisense; GCTGGGACCCGGAGACTATAACTTT
>probe:Drosophila_2:1637754_at:254:131; Interrogation_Position=293; Antisense; ACCTGCCGCCGGATCATGAGTACAA
>probe:Drosophila_2:1637754_at:598:663; Interrogation_Position=313; Antisense; TACAAGACCTGGGAGCGCTGGCTTA
>probe:Drosophila_2:1637754_at:711:31; Interrogation_Position=356; Antisense; ATAAGCTGCTCGATCTGCTGGAGAC
>probe:Drosophila_2:1637754_at:304:139; Interrogation_Position=428; Antisense; ACGTCTTCCATCACATGTACATGCT
>probe:Drosophila_2:1637754_at:221:455; Interrogation_Position=485; Antisense; GATACGGTGGTCATGGGTTCTTTAT
>probe:Drosophila_2:1637754_at:290:699; Interrogation_Position=505; Antisense; TTTATGTGCTTCTTCAACGTCGTCG
>probe:Drosophila_2:1637754_at:546:197; Interrogation_Position=520; Antisense; AACGTCGTCGTGCACATCATGATGT
>probe:Drosophila_2:1637754_at:83:665; Interrogation_Position=544; Antisense; TACAGCTACTACTATCAGTCGTCGC
>probe:Drosophila_2:1637754_at:274:89; Interrogation_Position=605; Antisense; AGTACATCACTATCGTTCAGCTCAT
>probe:Drosophila_2:1637754_at:186:483; Interrogation_Position=656; Antisense; GTATCTACACCCTAAAGCAACCGGA
>probe:Drosophila_2:1637754_at:489:39; Interrogation_Position=721; Antisense; ATCTCCGTTGTGTTCATCATCTTAT
>probe:Drosophila_2:1637754_at:233:701; Interrogation_Position=759; Antisense; TTTTCATGCCTATATTCGACCCAAG

Paste this into a BLAST search page for me
ATCATGTGCTTTTTTGCTGTCCACTGCTGGGACCCGGAGACTATAACTTTACCTGCCGCCGGATCATGAGTACAATACAAGACCTGGGAGCGCTGGCTTAATAAGCTGCTCGATCTGCTGGAGACACGTCTTCCATCACATGTACATGCTGATACGGTGGTCATGGGTTCTTTATTTTATGTGCTTCTTCAACGTCGTCGAACGTCGTCGTGCACATCATGATGTTACAGCTACTACTATCAGTCGTCGCAGTACATCACTATCGTTCAGCTCATGTATCTACACCCTAAAGCAACCGGAATCTCCGTTGTGTTCATCATCTTATTTTTCATGCCTATATTCGACCCAAG

Full Affymetrix probeset data:

Annotations for 1637754_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720