FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637756_at:

>probe:Drosophila_2:1637756_at:279:603; Interrogation_Position=1010; Antisense; TGATCTTCGACGACCTTTCCGAATA
>probe:Drosophila_2:1637756_at:492:695; Interrogation_Position=1025; Antisense; TTTCCGAATATCTAGTCCTGCGCGA
>probe:Drosophila_2:1637756_at:526:21; Interrogation_Position=1069; Antisense; ATATTTCCGGTGTCTGTCGATCGAT
>probe:Drosophila_2:1637756_at:123:113; Interrogation_Position=1112; Antisense; AGCAAAAGCTATTCGCTGAGCCCGC
>probe:Drosophila_2:1637756_at:614:579; Interrogation_Position=1145; Antisense; TGGCCACCAATCTCTGTTTTAATCA
>probe:Drosophila_2:1637756_at:505:237; Interrogation_Position=1165; Antisense; AATCAGTTTATGTTGTTCAGTCCCC
>probe:Drosophila_2:1637756_at:503:565; Interrogation_Position=1214; Antisense; GGCACCTTTTCGAAGACCACATGAT
>probe:Drosophila_2:1637756_at:138:607; Interrogation_Position=1235; Antisense; TGATGCGGCAGCATGAGTTTGGCCT
>probe:Drosophila_2:1637756_at:569:689; Interrogation_Position=1252; Antisense; TTTGGCCTGGTGACTTTCTGGAAGA
>probe:Drosophila_2:1637756_at:36:395; Interrogation_Position=1291; Antisense; GAAATGGTCAGACTTGGCCTGGCAT
>probe:Drosophila_2:1637756_at:122:579; Interrogation_Position=1306; Antisense; GGCCTGGCATCCATGGAGGATCTTA
>probe:Drosophila_2:1637756_at:711:415; Interrogation_Position=1353; Antisense; GAGCCTATTGCTGGACGATATCTCA
>probe:Drosophila_2:1637756_at:717:425; Interrogation_Position=902; Antisense; GAGATATTGGAAACTCTTCGCTTAA
>probe:Drosophila_2:1637756_at:111:467; Interrogation_Position=942; Antisense; GTTGGAAGTGAATGTCCTCACCTCC

Paste this into a BLAST search page for me
TGATCTTCGACGACCTTTCCGAATATTTCCGAATATCTAGTCCTGCGCGAATATTTCCGGTGTCTGTCGATCGATAGCAAAAGCTATTCGCTGAGCCCGCTGGCCACCAATCTCTGTTTTAATCAAATCAGTTTATGTTGTTCAGTCCCCGGCACCTTTTCGAAGACCACATGATTGATGCGGCAGCATGAGTTTGGCCTTTTGGCCTGGTGACTTTCTGGAAGAGAAATGGTCAGACTTGGCCTGGCATGGCCTGGCATCCATGGAGGATCTTAGAGCCTATTGCTGGACGATATCTCAGAGATATTGGAAACTCTTCGCTTAAGTTGGAAGTGAATGTCCTCACCTCC

Full Affymetrix probeset data:

Annotations for 1637756_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720