FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637757_at:

>probe:Drosophila_2:1637757_at:587:347; Interrogation_Position=1037; Antisense; GCAGGGCCAAGATGTACCGCAGTTT
>probe:Drosophila_2:1637757_at:180:695; Interrogation_Position=1059; Antisense; TTTCTGCCACCTTCTCGGGTTGTAA
>probe:Drosophila_2:1637757_at:577:193; Interrogation_Position=526; Antisense; AACTCCCTAACGTGTGTGCACTTTG
>probe:Drosophila_2:1637757_at:248:445; Interrogation_Position=571; Antisense; GATGACTACCTGTTGATCGAGCCGC
>probe:Drosophila_2:1637757_at:174:415; Interrogation_Position=589; Antisense; GAGCCGCCTTTGGAAGGACCGCAAG
>probe:Drosophila_2:1637757_at:525:609; Interrogation_Position=645; Antisense; TGAGCAGGTGGTGTCCCTCCAGAGA
>probe:Drosophila_2:1637757_at:198:423; Interrogation_Position=666; Antisense; GAGACCCGACGAGAATAGTGCCCAC
>probe:Drosophila_2:1637757_at:647:673; Interrogation_Position=745; Antisense; TACCACGAACAGTCACGAGCAGATC
>probe:Drosophila_2:1637757_at:513:397; Interrogation_Position=772; Antisense; GACAACTTTGTCAAGATCCACTGGG
>probe:Drosophila_2:1637757_at:388:47; Interrogation_Position=787; Antisense; ATCCACTGGGACAACATTGTGCCGC
>probe:Drosophila_2:1637757_at:571:669; Interrogation_Position=868; Antisense; TACGACTACAACTCCGTGATGCACT
>probe:Drosophila_2:1637757_at:277:49; Interrogation_Position=886; Antisense; ATGCACTACGGCGAGTTTTACTTCA
>probe:Drosophila_2:1637757_at:573:601; Interrogation_Position=938; Antisense; TGACCCCTCTACAACCTGGAGTTAG
>probe:Drosophila_2:1637757_at:245:649; Interrogation_Position=983; Antisense; TCAGCAAGATCGACTGCCTCAAGAT

Paste this into a BLAST search page for me
GCAGGGCCAAGATGTACCGCAGTTTTTTCTGCCACCTTCTCGGGTTGTAAAACTCCCTAACGTGTGTGCACTTTGGATGACTACCTGTTGATCGAGCCGCGAGCCGCCTTTGGAAGGACCGCAAGTGAGCAGGTGGTGTCCCTCCAGAGAGAGACCCGACGAGAATAGTGCCCACTACCACGAACAGTCACGAGCAGATCGACAACTTTGTCAAGATCCACTGGGATCCACTGGGACAACATTGTGCCGCTACGACTACAACTCCGTGATGCACTATGCACTACGGCGAGTTTTACTTCATGACCCCTCTACAACCTGGAGTTAGTCAGCAAGATCGACTGCCTCAAGAT

Full Affymetrix probeset data:

Annotations for 1637757_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720