Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637758_at:

>probe:Drosophila_2:1637758_at:293:399; Interrogation_Position=1734; Antisense; GACAGCGATACCTGACCCAGTTATA
>probe:Drosophila_2:1637758_at:126:677; Interrogation_Position=1769; Antisense; TAGAATTCTGTCTTCGCACTACAAG
>probe:Drosophila_2:1637758_at:48:183; Interrogation_Position=1805; Antisense; AAAACTGATCAGTACATCCTGGATA
>probe:Drosophila_2:1637758_at:229:543; Interrogation_Position=1825; Antisense; GGATAGACTTCATATGCCTAAGCTA
>probe:Drosophila_2:1637758_at:279:245; Interrogation_Position=1852; Antisense; AATTTACACATTTGCCATAGGTTAG
>probe:Drosophila_2:1637758_at:339:243; Interrogation_Position=1925; Antisense; AATATGTCAACAAGTGCGCTGCCCA
>probe:Drosophila_2:1637758_at:574:323; Interrogation_Position=1940; Antisense; GCGCTGCCCAATAAAGCTGTGTTTA
>probe:Drosophila_2:1637758_at:6:333; Interrogation_Position=1955; Antisense; GCTGTGTTTAAGTCTTCTCTAACCT
>probe:Drosophila_2:1637758_at:175:339; Interrogation_Position=2014; Antisense; GCTAATGAAAAACGCTTCCCTCTCA
>probe:Drosophila_2:1637758_at:562:275; Interrogation_Position=2028; Antisense; CTTCCCTCTCAATCGCATTTAAAAT
>probe:Drosophila_2:1637758_at:150:15; Interrogation_Position=2067; Antisense; ATTAGTTTCTCACTTGTTTTCAACA
>probe:Drosophila_2:1637758_at:229:501; Interrogation_Position=2138; Antisense; GTCGTCACACAGAACTTCACATTGT
>probe:Drosophila_2:1637758_at:712:483; Interrogation_Position=2161; Antisense; GTATCCAATATGCTTCAGTTAGTGA
>probe:Drosophila_2:1637758_at:63:531; Interrogation_Position=2234; Antisense; GGGATTAACTCTGTACTTTGATTTC

Paste this into a BLAST search page for me
GACAGCGATACCTGACCCAGTTATATAGAATTCTGTCTTCGCACTACAAGAAAACTGATCAGTACATCCTGGATAGGATAGACTTCATATGCCTAAGCTAAATTTACACATTTGCCATAGGTTAGAATATGTCAACAAGTGCGCTGCCCAGCGCTGCCCAATAAAGCTGTGTTTAGCTGTGTTTAAGTCTTCTCTAACCTGCTAATGAAAAACGCTTCCCTCTCACTTCCCTCTCAATCGCATTTAAAATATTAGTTTCTCACTTGTTTTCAACAGTCGTCACACAGAACTTCACATTGTGTATCCAATATGCTTCAGTTAGTGAGGGATTAACTCTGTACTTTGATTTC

Full Affymetrix probeset data:

Annotations for 1637758_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime