FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637761_at:

>probe:Drosophila_2:1637761_at:249:531; Interrogation_Position=103; Antisense; GGGTATTCGATTTCTCAGCTACCAT
>probe:Drosophila_2:1637761_at:265:293; Interrogation_Position=110; Antisense; CGATTTCTCAGCTACCATAAGTTGG
>probe:Drosophila_2:1637761_at:644:129; Interrogation_Position=123; Antisense; ACCATAAGTTGGTTACTGCGACAAT
>probe:Drosophila_2:1637761_at:89:473; Interrogation_Position=134; Antisense; GTTACTGCGACAATGGGCCAAGATT
>probe:Drosophila_2:1637761_at:427:397; Interrogation_Position=142; Antisense; GACAATGGGCCAAGATTCGTCTTAT
>probe:Drosophila_2:1637761_at:531:463; Interrogation_Position=155; Antisense; GATTCGTCTTATAAAAGCGGTCTTA
>probe:Drosophila_2:1637761_at:636:173; Interrogation_Position=168; Antisense; AAAGCGGTCTTAGCCAAGCACTTAC
>probe:Drosophila_2:1637761_at:557:207; Interrogation_Position=183; Antisense; AAGCACTTACTCATCAGTCGTCTGC
>probe:Drosophila_2:1637761_at:407:707; Interrogation_Position=189; Antisense; TTACTCATCAGTCGTCTGCACTCCA
>probe:Drosophila_2:1637761_at:585:615; Interrogation_Position=205; Antisense; TGCACTCCATCGCTTCAGTTACAAC
>probe:Drosophila_2:1637761_at:103:221; Interrogation_Position=21; Antisense; AAGTGCAGGGATTTGGTTTCATTTC
>probe:Drosophila_2:1637761_at:228:43; Interrogation_Position=213; Antisense; ATCGCTTCAGTTACAACTCCAACTT
>probe:Drosophila_2:1637761_at:675:301; Interrogation_Position=46; Antisense; CCCCACGGGCGAGGTATATATGGTA
>probe:Drosophila_2:1637761_at:20:599; Interrogation_Position=77; Antisense; TTGCATAAGGCATGGGTTTCGGAGC

Paste this into a BLAST search page for me
GGGTATTCGATTTCTCAGCTACCATCGATTTCTCAGCTACCATAAGTTGGACCATAAGTTGGTTACTGCGACAATGTTACTGCGACAATGGGCCAAGATTGACAATGGGCCAAGATTCGTCTTATGATTCGTCTTATAAAAGCGGTCTTAAAAGCGGTCTTAGCCAAGCACTTACAAGCACTTACTCATCAGTCGTCTGCTTACTCATCAGTCGTCTGCACTCCATGCACTCCATCGCTTCAGTTACAACAAGTGCAGGGATTTGGTTTCATTTCATCGCTTCAGTTACAACTCCAACTTCCCCACGGGCGAGGTATATATGGTATTGCATAAGGCATGGGTTTCGGAGC

Full Affymetrix probeset data:

Annotations for 1637761_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720