FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637764_at:

>probe:Drosophila_2:1637764_at:596:287; Interrogation_Position=2170; Antisense; CTGGAGACCAATCGCATTCCGGTGG
>probe:Drosophila_2:1637764_at:230:123; Interrogation_Position=2200; Antisense; AGCGAAACCATCTATTGCACAGCCA
>probe:Drosophila_2:1637764_at:282:423; Interrogation_Position=2259; Antisense; GAGAAGACTCTACACGCGGTCAAAT
>probe:Drosophila_2:1637764_at:417:213; Interrogation_Position=2291; Antisense; AAGAGCGACGGATCCTTCTGAGTGC
>probe:Drosophila_2:1637764_at:303:87; Interrogation_Position=2311; Antisense; AGTGCCATGGCCTGCAGTCGAGAAA
>probe:Drosophila_2:1637764_at:660:585; Interrogation_Position=2345; Antisense; TGGACAAGCTGCTCAACCTGGCATT
>probe:Drosophila_2:1637764_at:624:221; Interrogation_Position=2389; Antisense; AAGGATGATGTCCTGCTGATCTTCA
>probe:Drosophila_2:1637764_at:198:577; Interrogation_Position=2421; Antisense; GGCGCAGAATCCTTTGGGCTACAAC
>probe:Drosophila_2:1637764_at:268:533; Interrogation_Position=2463; Antisense; GGTGGACAACATCAAGGCAATCATT
>probe:Drosophila_2:1637764_at:656:583; Interrogation_Position=2516; Antisense; TGGCACAGCTAGTTACCGTTCTTAT
>probe:Drosophila_2:1637764_at:246:609; Interrogation_Position=2588; Antisense; TGAGAACCGATCTTCAGAACCTTCC
>probe:Drosophila_2:1637764_at:92:27; Interrogation_Position=2623; Antisense; ATAGCCTTTCGTCGAATCCTGGAAC
>probe:Drosophila_2:1637764_at:613:621; Interrogation_Position=2693; Antisense; TGCTGGCCGCCGTTTGCAATATAAC
>probe:Drosophila_2:1637764_at:704:29; Interrogation_Position=2713; Antisense; ATAACCGGGTCCATAGAGCCGCAGT

Paste this into a BLAST search page for me
CTGGAGACCAATCGCATTCCGGTGGAGCGAAACCATCTATTGCACAGCCAGAGAAGACTCTACACGCGGTCAAATAAGAGCGACGGATCCTTCTGAGTGCAGTGCCATGGCCTGCAGTCGAGAAATGGACAAGCTGCTCAACCTGGCATTAAGGATGATGTCCTGCTGATCTTCAGGCGCAGAATCCTTTGGGCTACAACGGTGGACAACATCAAGGCAATCATTTGGCACAGCTAGTTACCGTTCTTATTGAGAACCGATCTTCAGAACCTTCCATAGCCTTTCGTCGAATCCTGGAACTGCTGGCCGCCGTTTGCAATATAACATAACCGGGTCCATAGAGCCGCAGT

Full Affymetrix probeset data:

Annotations for 1637764_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720