FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637765_at:

>probe:Drosophila_2:1637765_at:605:589; Interrogation_Position=180; Antisense; TGGTTACCACCATGAGGAACTGCCT
>probe:Drosophila_2:1637765_at:712:555; Interrogation_Position=213; Antisense; GGACGCTGAGATCCATCATTCGGAT
>probe:Drosophila_2:1637765_at:211:273; Interrogation_Position=229; Antisense; CATTCGGATGGCATCCATCTGGGAC
>probe:Drosophila_2:1637765_at:311:39; Interrogation_Position=245; Antisense; ATCTGGGACACAGTGCCGCTTTGGT
>probe:Drosophila_2:1637765_at:719:625; Interrogation_Position=258; Antisense; TGCCGCTTTGGTGCACGATGATCAC
>probe:Drosophila_2:1637765_at:541:443; Interrogation_Position=274; Antisense; GATGATCACCATCTGAACCATCATT
>probe:Drosophila_2:1637765_at:46:381; Interrogation_Position=288; Antisense; GAACCATCATTTGGATCATCATTTG
>probe:Drosophila_2:1637765_at:227:729; Interrogation_Position=310; Antisense; TTGGATCACCACCTGGTTGAGTCGC
>probe:Drosophila_2:1637765_at:664:725; Interrogation_Position=326; Antisense; TTGAGTCGCTGCCAACCACAGTGTA
>probe:Drosophila_2:1637765_at:502:153; Interrogation_Position=343; Antisense; ACAGTGTACCACCATGAGCCACTTC
>probe:Drosophila_2:1637765_at:462:351; Interrogation_Position=504; Antisense; GCACGCCCTGCACGGAAAGTACGGA
>probe:Drosophila_2:1637765_at:238:545; Interrogation_Position=536; Antisense; GGATCACCGAGACCCATTATTGAGA
>probe:Drosophila_2:1637765_at:216:153; Interrogation_Position=571; Antisense; ACATCCATTGTCCATAAAACCTCTG
>probe:Drosophila_2:1637765_at:497:337; Interrogation_Position=600; Antisense; GCTCCCTCATGGCTCATAATTTATT

Paste this into a BLAST search page for me
TGGTTACCACCATGAGGAACTGCCTGGACGCTGAGATCCATCATTCGGATCATTCGGATGGCATCCATCTGGGACATCTGGGACACAGTGCCGCTTTGGTTGCCGCTTTGGTGCACGATGATCACGATGATCACCATCTGAACCATCATTGAACCATCATTTGGATCATCATTTGTTGGATCACCACCTGGTTGAGTCGCTTGAGTCGCTGCCAACCACAGTGTAACAGTGTACCACCATGAGCCACTTCGCACGCCCTGCACGGAAAGTACGGAGGATCACCGAGACCCATTATTGAGAACATCCATTGTCCATAAAACCTCTGGCTCCCTCATGGCTCATAATTTATT

Full Affymetrix probeset data:

Annotations for 1637765_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720