FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637766_at:

>probe:Drosophila_2:1637766_at:589:559; Interrogation_Position=296; Antisense; GGACAAGTTGACTCGCTATGGCACG
>probe:Drosophila_2:1637766_at:630:727; Interrogation_Position=330; Antisense; TTGGAGTTCTCGATGGCGCCCAGAA
>probe:Drosophila_2:1637766_at:325:323; Interrogation_Position=345; Antisense; GCGCCCAGAACCAATGTCATCGATA
>probe:Drosophila_2:1637766_at:459:455; Interrogation_Position=366; Antisense; GATAAGCGAAGCAGTCCCGGTCCGG
>probe:Drosophila_2:1637766_at:91:505; Interrogation_Position=385; Antisense; GTCCGGGAGCACACGATGTTCATAA
>probe:Drosophila_2:1637766_at:213:531; Interrogation_Position=427; Antisense; GGGTTAATGCTCCTTCGTATTCGAT
>probe:Drosophila_2:1637766_at:222:637; Interrogation_Position=447; Antisense; TCGATGGGCCTACGAACGGACTTTA
>probe:Drosophila_2:1637766_at:451:209; Interrogation_Position=477; Antisense; AAGAAGGATGGTCCCGGTCCCAATG
>probe:Drosophila_2:1637766_at:251:631; Interrogation_Position=530; Antisense; TCCTGGAGTCCCGAGCTATAGCATG
>probe:Drosophila_2:1637766_at:495:385; Interrogation_Position=575; Antisense; GAACAAGACGAATTCTCCGGGTCCG
>probe:Drosophila_2:1637766_at:119:495; Interrogation_Position=627; Antisense; GTCAAACTGACACGTGCTCCGATAT
>probe:Drosophila_2:1637766_at:507:395; Interrogation_Position=684; Antisense; GAGAATGTCGGACCTGGACCCAACT
>probe:Drosophila_2:1637766_at:84:647; Interrogation_Position=718; Antisense; TCATGTACTATCGTCCTGGCAAGAG
>probe:Drosophila_2:1637766_at:518:471; Interrogation_Position=779; Antisense; GTTCGCTCCGCCTATGATAGTTAGA

Paste this into a BLAST search page for me
GGACAAGTTGACTCGCTATGGCACGTTGGAGTTCTCGATGGCGCCCAGAAGCGCCCAGAACCAATGTCATCGATAGATAAGCGAAGCAGTCCCGGTCCGGGTCCGGGAGCACACGATGTTCATAAGGGTTAATGCTCCTTCGTATTCGATTCGATGGGCCTACGAACGGACTTTAAAGAAGGATGGTCCCGGTCCCAATGTCCTGGAGTCCCGAGCTATAGCATGGAACAAGACGAATTCTCCGGGTCCGGTCAAACTGACACGTGCTCCGATATGAGAATGTCGGACCTGGACCCAACTTCATGTACTATCGTCCTGGCAAGAGGTTCGCTCCGCCTATGATAGTTAGA

Full Affymetrix probeset data:

Annotations for 1637766_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720