Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637767_at:

>probe:Drosophila_2:1637767_at:373:685; Interrogation_Position=1030; Antisense; TATCATATCTGTGTGCTAGGCGTCG
>probe:Drosophila_2:1637767_at:333:41; Interrogation_Position=1036; Antisense; ATCTGTGTGCTAGGCGTCGTTCCAC
>probe:Drosophila_2:1637767_at:75:303; Interrogation_Position=1063; Antisense; CCCGCGGTTACATGAGCTTCTAATA
>probe:Drosophila_2:1637767_at:501:151; Interrogation_Position=1093; Antisense; ACATCAGCTTAATTGGGCAGGTTGC
>probe:Drosophila_2:1637767_at:664:211; Interrogation_Position=1223; Antisense; AAGAGGGTCATCGAAATCATCAAGC
>probe:Drosophila_2:1637767_at:670:237; Interrogation_Position=1237; Antisense; AATCATCAAGCGCAATTGGGTTTAG
>probe:Drosophila_2:1637767_at:407:499; Interrogation_Position=1295; Antisense; GTCTCTGTCTTTGTAAGTGTCCGAT
>probe:Drosophila_2:1637767_at:89:509; Interrogation_Position=1311; Antisense; GTGTCCGATATTGGTTCTTGTATGC
>probe:Drosophila_2:1637767_at:65:541; Interrogation_Position=1323; Antisense; GGTTCTTGTATGCTGATATTTGTGT
>probe:Drosophila_2:1637767_at:301:31; Interrogation_Position=1415; Antisense; ATAATGTAGCTACCGTGTTAACCCT
>probe:Drosophila_2:1637767_at:26:435; Interrogation_Position=1457; Antisense; GAGGACATTTCTATTGTTAAGGCAA
>probe:Drosophila_2:1637767_at:471:563; Interrogation_Position=1477; Antisense; GGCAAAAACCTGTACGCAATACCAA
>probe:Drosophila_2:1637767_at:671:167; Interrogation_Position=1558; Antisense; AAATGTGTGTATTCCTGACCTTAAC
>probe:Drosophila_2:1637767_at:431:513; Interrogation_Position=1564; Antisense; GTGTATTCCTGACCTTAACTGTAAT

Paste this into a BLAST search page for me
TATCATATCTGTGTGCTAGGCGTCGATCTGTGTGCTAGGCGTCGTTCCACCCCGCGGTTACATGAGCTTCTAATAACATCAGCTTAATTGGGCAGGTTGCAAGAGGGTCATCGAAATCATCAAGCAATCATCAAGCGCAATTGGGTTTAGGTCTCTGTCTTTGTAAGTGTCCGATGTGTCCGATATTGGTTCTTGTATGCGGTTCTTGTATGCTGATATTTGTGTATAATGTAGCTACCGTGTTAACCCTGAGGACATTTCTATTGTTAAGGCAAGGCAAAAACCTGTACGCAATACCAAAAATGTGTGTATTCCTGACCTTAACGTGTATTCCTGACCTTAACTGTAAT

Full Affymetrix probeset data:

Annotations for 1637767_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime