FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637768_at:

>probe:Drosophila_2:1637768_at:466:635; Interrogation_Position=161; Antisense; TCGTTACGGCAATCACCTAAAGCTG
>probe:Drosophila_2:1637768_at:707:117; Interrogation_Position=181; Antisense; AGCTGACCGACAAGAACTACTTTCT
>probe:Drosophila_2:1637768_at:104:147; Interrogation_Position=196; Antisense; ACTACTTTCTGGGAAGAGTTCGCCA
>probe:Drosophila_2:1637768_at:434:427; Interrogation_Position=211; Antisense; GAGTTCGCCACGAGTTTCGGGACAA
>probe:Drosophila_2:1637768_at:396:515; Interrogation_Position=239; Antisense; TTCCCTTACGAATCCCGTGGAAGTG
>probe:Drosophila_2:1637768_at:631:709; Interrogation_Position=274; Antisense; TTAAGCGCGGAGAGACCCTGCTAAA
>probe:Drosophila_2:1637768_at:554:233; Interrogation_Position=319; Antisense; AATGCTGCGAGGTCTGGTGCGATTC
>probe:Drosophila_2:1637768_at:528:285; Interrogation_Position=363; Antisense; CTGTGCGCTGCAAGTCCAATCTGGA
>probe:Drosophila_2:1637768_at:480:695; Interrogation_Position=398; Antisense; TTTCCCGTGCTTCAGGAGTCGGATA
>probe:Drosophila_2:1637768_at:137:685; Interrogation_Position=421; Antisense; TATCGAGGAGACCTTCATGCGCGGC
>probe:Drosophila_2:1637768_at:589:211; Interrogation_Position=473; Antisense; AAGACATCCAACTGCGTGTTCTTGC
>probe:Drosophila_2:1637768_at:520:221; Interrogation_Position=524; Antisense; AAGTGTCACACACATCGTCTAGCAT
>probe:Drosophila_2:1637768_at:397:547; Interrogation_Position=562; Antisense; GGAGGCTCGTAAACTTCTACTGGAA
>probe:Drosophila_2:1637768_at:358:425; Interrogation_Position=609; Antisense; GAGAGCATTCAATTGCCGCGCAAGT

Paste this into a BLAST search page for me
TCGTTACGGCAATCACCTAAAGCTGAGCTGACCGACAAGAACTACTTTCTACTACTTTCTGGGAAGAGTTCGCCAGAGTTCGCCACGAGTTTCGGGACAATTCCCTTACGAATCCCGTGGAAGTGTTAAGCGCGGAGAGACCCTGCTAAAAATGCTGCGAGGTCTGGTGCGATTCCTGTGCGCTGCAAGTCCAATCTGGATTTCCCGTGCTTCAGGAGTCGGATATATCGAGGAGACCTTCATGCGCGGCAAGACATCCAACTGCGTGTTCTTGCAAGTGTCACACACATCGTCTAGCATGGAGGCTCGTAAACTTCTACTGGAAGAGAGCATTCAATTGCCGCGCAAGT

Full Affymetrix probeset data:

Annotations for 1637768_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720