Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637769_s_at:

>probe:Drosophila_2:1637769_s_at:541:195; Interrogation_Position=387; Antisense; AACTGGCGATTTCGGACATTGTCCA
>probe:Drosophila_2:1637769_s_at:241:151; Interrogation_Position=402; Antisense; ACATTGTCCACGTGTCTACTGTGAA
>probe:Drosophila_2:1637769_s_at:674:669; Interrogation_Position=418; Antisense; TACTGTGAAAGTCAGCCCATGCTGC
>probe:Drosophila_2:1637769_s_at:5:621; Interrogation_Position=437; Antisense; TGCTGCCATTGGGTCTGTCGGACAT
>probe:Drosophila_2:1637769_s_at:414:569; Interrogation_Position=476; Antisense; TGGTTAAGACCTATTGCCCCAAGTG
>probe:Drosophila_2:1637769_s_at:219:321; Interrogation_Position=491; Antisense; GCCCCAAGTGCATTGACGTGTACAC
>probe:Drosophila_2:1637769_s_at:297:601; Interrogation_Position=509; Antisense; TGTACACACCAAAATCGTCGCGTCA
>probe:Drosophila_2:1637769_s_at:65:441; Interrogation_Position=544; Antisense; GATGGCGCCTATTTCGGCACTGGAT
>probe:Drosophila_2:1637769_s_at:565:589; Interrogation_Position=564; Antisense; TGGATTTCCACACATGCTCTTCATG
>probe:Drosophila_2:1637769_s_at:14:713; Interrogation_Position=583; Antisense; TTCATGGTGCATCCCGAATATCGTC
>probe:Drosophila_2:1637769_s_at:107:363; Interrogation_Position=598; Antisense; GAATATCGTCCCAAGCGTCCTACTA
>probe:Drosophila_2:1637769_s_at:337:329; Interrogation_Position=612; Antisense; GCGTCCTACTAATCAGTTTGTTCCA
>probe:Drosophila_2:1637769_s_at:172:277; Interrogation_Position=668; Antisense; CTTATCAAATTCAGCTGCAGGCAGC
>probe:Drosophila_2:1637769_s_at:474:135; Interrogation_Position=948; Antisense; ACGCTGGGCGCAAAGTTTCATTTAT

Paste this into a BLAST search page for me
AACTGGCGATTTCGGACATTGTCCAACATTGTCCACGTGTCTACTGTGAATACTGTGAAAGTCAGCCCATGCTGCTGCTGCCATTGGGTCTGTCGGACATTGGTTAAGACCTATTGCCCCAAGTGGCCCCAAGTGCATTGACGTGTACACTGTACACACCAAAATCGTCGCGTCAGATGGCGCCTATTTCGGCACTGGATTGGATTTCCACACATGCTCTTCATGTTCATGGTGCATCCCGAATATCGTCGAATATCGTCCCAAGCGTCCTACTAGCGTCCTACTAATCAGTTTGTTCCACTTATCAAATTCAGCTGCAGGCAGCACGCTGGGCGCAAAGTTTCATTTAT

Full Affymetrix probeset data:

Annotations for 1637769_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime