Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637772_at:

>probe:Drosophila_2:1637772_at:708:569; Interrogation_Position=1479; Antisense; GGCTACGCTACCTGGTATTGTTGTC
>probe:Drosophila_2:1637772_at:99:577; Interrogation_Position=1553; Antisense; GGCGCATCATTTTCGGAGTGACCAT
>probe:Drosophila_2:1637772_at:341:601; Interrogation_Position=1583; Antisense; TGTTCGCCTTGGAATTCCTGGTATT
>probe:Drosophila_2:1637772_at:85:481; Interrogation_Position=1603; Antisense; GTATTCGTCTTCTTGGGATCGGGCA
>probe:Drosophila_2:1637772_at:238:387; Interrogation_Position=1641; Antisense; GAACAAGGCCGGAACTCCCAAGGAT
>probe:Drosophila_2:1637772_at:706:371; Interrogation_Position=1695; Antisense; GAAGGAGCTGCCAACTAAGCCCTAA
>probe:Drosophila_2:1637772_at:114:365; Interrogation_Position=1737; Antisense; GAATCTTCTGCCTCAATTACTCGAC
>probe:Drosophila_2:1637772_at:91:15; Interrogation_Position=1752; Antisense; ATTACTCGACGAACTGCTGCTTATT
>probe:Drosophila_2:1637772_at:260:335; Interrogation_Position=1767; Antisense; GCTGCTTATTCGGATAACTCTTGGA
>probe:Drosophila_2:1637772_at:483:231; Interrogation_Position=1852; Antisense; AATGCCCACCCTGAATAGCGAATTC
>probe:Drosophila_2:1637772_at:662:611; Interrogation_Position=1879; Antisense; TGAACATACGTTCGCTATTTAGGGC
>probe:Drosophila_2:1637772_at:163:523; Interrogation_Position=1900; Antisense; GGGCGTGCACTGTAGTTTTTAGATC
>probe:Drosophila_2:1637772_at:646:127; Interrogation_Position=1932; Antisense; ACCAATAGTTAGTAGCCGTATCCAT
>probe:Drosophila_2:1637772_at:201:713; Interrogation_Position=1970; Antisense; TTCAGCCCGCCTAATGTACTTAACA

Paste this into a BLAST search page for me
GGCTACGCTACCTGGTATTGTTGTCGGCGCATCATTTTCGGAGTGACCATTGTTCGCCTTGGAATTCCTGGTATTGTATTCGTCTTCTTGGGATCGGGCAGAACAAGGCCGGAACTCCCAAGGATGAAGGAGCTGCCAACTAAGCCCTAAGAATCTTCTGCCTCAATTACTCGACATTACTCGACGAACTGCTGCTTATTGCTGCTTATTCGGATAACTCTTGGAAATGCCCACCCTGAATAGCGAATTCTGAACATACGTTCGCTATTTAGGGCGGGCGTGCACTGTAGTTTTTAGATCACCAATAGTTAGTAGCCGTATCCATTTCAGCCCGCCTAATGTACTTAACA

Full Affymetrix probeset data:

Annotations for 1637772_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime