FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637775_at:

>probe:Drosophila_2:1637775_at:218:665; Interrogation_Position=1025; Antisense; TACAGCTACGGCGACCAATGGACCA
>probe:Drosophila_2:1637775_at:324:413; Interrogation_Position=1045; Antisense; GACCACCGCCGTCCATGAGGGAGAA
>probe:Drosophila_2:1637775_at:282:703; Interrogation_Position=1142; Antisense; TTTTGCTTTCAATTGCGGCTTAATC
>probe:Drosophila_2:1637775_at:372:573; Interrogation_Position=682; Antisense; GGCTGCTGTGCGATTTGCTTTGGTC
>probe:Drosophila_2:1637775_at:435:501; Interrogation_Position=737; Antisense; GTCCAACGATCGAGGTGTCAGCTTC
>probe:Drosophila_2:1637775_at:446:515; Interrogation_Position=751; Antisense; GTGTCAGCTTCACCTTTGGAGCCAA
>probe:Drosophila_2:1637775_at:624:311; Interrogation_Position=771; Antisense; GCCAACATAGTGGAGGGCTTCCTCA
>probe:Drosophila_2:1637775_at:338:571; Interrogation_Position=786; Antisense; GGCTTCCTCATGCAGCACAAGTTTA
>probe:Drosophila_2:1637775_at:515:249; Interrogation_Position=803; Antisense; CAAGTTTAACCTGATTGTCCGCGCC
>probe:Drosophila_2:1637775_at:332:303; Interrogation_Position=894; Antisense; CCGAACTACTGCGACATCTTTGATA
>probe:Drosophila_2:1637775_at:701:37; Interrogation_Position=909; Antisense; ATCTTTGATAACTGCGGAGCTGTTC
>probe:Drosophila_2:1637775_at:163:121; Interrogation_Position=926; Antisense; AGCTGTTCTGGTGGTGGACGCCAAA
>probe:Drosophila_2:1637775_at:363:143; Interrogation_Position=950; Antisense; ACTGGTCTGCCACTTTGTCATCATC
>probe:Drosophila_2:1637775_at:371:133; Interrogation_Position=995; Antisense; ACCCACGGGCTTTGAGTCGGATAGT

Paste this into a BLAST search page for me
TACAGCTACGGCGACCAATGGACCAGACCACCGCCGTCCATGAGGGAGAATTTTGCTTTCAATTGCGGCTTAATCGGCTGCTGTGCGATTTGCTTTGGTCGTCCAACGATCGAGGTGTCAGCTTCGTGTCAGCTTCACCTTTGGAGCCAAGCCAACATAGTGGAGGGCTTCCTCAGGCTTCCTCATGCAGCACAAGTTTACAAGTTTAACCTGATTGTCCGCGCCCCGAACTACTGCGACATCTTTGATAATCTTTGATAACTGCGGAGCTGTTCAGCTGTTCTGGTGGTGGACGCCAAAACTGGTCTGCCACTTTGTCATCATCACCCACGGGCTTTGAGTCGGATAGT

Full Affymetrix probeset data:

Annotations for 1637775_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720