FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637776_at:

>probe:Drosophila_2:1637776_at:439:47; Interrogation_Position=141; Antisense; ATCCGGAGCCATTGCCGTTGGCCAG
>probe:Drosophila_2:1637776_at:173:465; Interrogation_Position=157; Antisense; GTTGGCCAGTCCACAAATCCAGTGG
>probe:Drosophila_2:1637776_at:477:505; Interrogation_Position=165; Antisense; GTCCACAAATCCAGTGGCGCAGCAG
>probe:Drosophila_2:1637776_at:106:581; Interrogation_Position=207; Antisense; GGCCAAGAAGCCCAGTAGCGAGACA
>probe:Drosophila_2:1637776_at:145:181; Interrogation_Position=231; Antisense; AAACAACATGCCCACGCGACAGTAC
>probe:Drosophila_2:1637776_at:501:317; Interrogation_Position=273; Antisense; GCCGGTTCTGCTCCACGGAATGCAG
>probe:Drosophila_2:1637776_at:383:233; Interrogation_Position=291; Antisense; AATGCAGGCCCTGGCTCGCGAACGG
>probe:Drosophila_2:1637776_at:233:139; Interrogation_Position=319; Antisense; ACGGATCCCATACAGTTCCTGGCCT
>probe:Drosophila_2:1637776_at:553:581; Interrogation_Position=338; Antisense; TGGCCTCCTACCTACTAAAGCATAG
>probe:Drosophila_2:1637776_at:136:663; Interrogation_Position=353; Antisense; TAAAGCATAGCAACGGGTGCGACGA
>probe:Drosophila_2:1637776_at:428:531; Interrogation_Position=367; Antisense; GGGTGCGACGAGAACAACGCCTCCG
>probe:Drosophila_2:1637776_at:4:167; Interrogation_Position=57; Antisense; AAATCCGCCGGCAGAAGCTGGCAAG
>probe:Drosophila_2:1637776_at:529:361; Interrogation_Position=77; Antisense; GCAAGGAGCCAAATGCAAGCAGCAA
>probe:Drosophila_2:1637776_at:83:115; Interrogation_Position=94; Antisense; AGCAGCAATGCGCAAGCAAACCCGA

Paste this into a BLAST search page for me
ATCCGGAGCCATTGCCGTTGGCCAGGTTGGCCAGTCCACAAATCCAGTGGGTCCACAAATCCAGTGGCGCAGCAGGGCCAAGAAGCCCAGTAGCGAGACAAAACAACATGCCCACGCGACAGTACGCCGGTTCTGCTCCACGGAATGCAGAATGCAGGCCCTGGCTCGCGAACGGACGGATCCCATACAGTTCCTGGCCTTGGCCTCCTACCTACTAAAGCATAGTAAAGCATAGCAACGGGTGCGACGAGGGTGCGACGAGAACAACGCCTCCGAAATCCGCCGGCAGAAGCTGGCAAGGCAAGGAGCCAAATGCAAGCAGCAAAGCAGCAATGCGCAAGCAAACCCGA

Full Affymetrix probeset data:

Annotations for 1637776_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720