FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637777_at:

>probe:Drosophila_2:1637777_at:439:99; Interrogation_Position=434; Antisense; AGATGGGACTTGGAGCCTACCAGCG
>probe:Drosophila_2:1637777_at:354:629; Interrogation_Position=481; Antisense; TCCTCCTTGGATCTCGAGTGGGAAC
>probe:Drosophila_2:1637777_at:582:561; Interrogation_Position=501; Antisense; GGAACACGAGTACTCACAGCTGCGG
>probe:Drosophila_2:1637777_at:20:157; Interrogation_Position=516; Antisense; ACAGCTGCGGCAGTATCAGTACCAG
>probe:Drosophila_2:1637777_at:561:251; Interrogation_Position=637; Antisense; CAAGGACGACACATGGCGCGCCAAG
>probe:Drosophila_2:1637777_at:652:203; Interrogation_Position=659; Antisense; AAGCCAGACTGAGTTGCCAGCGCCA
>probe:Drosophila_2:1637777_at:626:133; Interrogation_Position=697; Antisense; ACGCGGAACTCGTGCTGTTCGTCTA
>probe:Drosophila_2:1637777_at:135:601; Interrogation_Position=712; Antisense; TGTTCGTCTACGCAAAACTCCTGGT
>probe:Drosophila_2:1637777_at:19:115; Interrogation_Position=791; Antisense; AGCAGCGTCAGCTTCGTCTGGAGGA
>probe:Drosophila_2:1637777_at:320:107; Interrogation_Position=832; Antisense; AGAACGCTCAAGTTGCTGCATCAGA
>probe:Drosophila_2:1637777_at:356:377; Interrogation_Position=867; Antisense; GAAGCACCATGTACTGCAGGAGACT
>probe:Drosophila_2:1637777_at:665:287; Interrogation_Position=890; Antisense; CTGGCGATGGACTCAGCATGGAATC
>probe:Drosophila_2:1637777_at:709:365; Interrogation_Position=910; Antisense; GAATCAGCTGCGGTCGAGGAGCTCA
>probe:Drosophila_2:1637777_at:649:73; Interrogation_Position=926; Antisense; AGGAGCTCACCGAGGGCCTTCAGTT

Paste this into a BLAST search page for me
AGATGGGACTTGGAGCCTACCAGCGTCCTCCTTGGATCTCGAGTGGGAACGGAACACGAGTACTCACAGCTGCGGACAGCTGCGGCAGTATCAGTACCAGCAAGGACGACACATGGCGCGCCAAGAAGCCAGACTGAGTTGCCAGCGCCAACGCGGAACTCGTGCTGTTCGTCTATGTTCGTCTACGCAAAACTCCTGGTAGCAGCGTCAGCTTCGTCTGGAGGAAGAACGCTCAAGTTGCTGCATCAGAGAAGCACCATGTACTGCAGGAGACTCTGGCGATGGACTCAGCATGGAATCGAATCAGCTGCGGTCGAGGAGCTCAAGGAGCTCACCGAGGGCCTTCAGTT

Full Affymetrix probeset data:

Annotations for 1637777_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720