Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637779_at:

>probe:Drosophila_2:1637779_at:6:349; Interrogation_Position=1327; Antisense; GCAGGCGCCTCCAACGGAGCTGGTC
>probe:Drosophila_2:1637779_at:206:281; Interrogation_Position=1401; Antisense; CTCACCATTTGTCGCAGCAGCTGCA
>probe:Drosophila_2:1637779_at:102:303; Interrogation_Position=1467; Antisense; CCCCGCAGTGGCTGGCCTGGGAAAT
>probe:Drosophila_2:1637779_at:296:315; Interrogation_Position=1481; Antisense; GCCTGGGAAATGTTACGCCCACCGA
>probe:Drosophila_2:1637779_at:252:453; Interrogation_Position=1504; Antisense; GATCTCTCGATGAAACCGACCAGCG
>probe:Drosophila_2:1637779_at:233:53; Interrogation_Position=1513; Antisense; ATGAAACCGACCAGCGGCCTTGGCG
>probe:Drosophila_2:1637779_at:434:577; Interrogation_Position=1528; Antisense; GGCCTTGGCGGCAACATGGTCAGCA
>probe:Drosophila_2:1637779_at:256:187; Interrogation_Position=1558; Antisense; AACAGCAACAGTTCCGTGACCGGCA
>probe:Drosophila_2:1637779_at:703:491; Interrogation_Position=1573; Antisense; GTGACCGGCAACATTAACTCGCAGC
>probe:Drosophila_2:1637779_at:440:661; Interrogation_Position=1587; Antisense; TAACTCGCAGCTAAGCGCCGCCAAT
>probe:Drosophila_2:1637779_at:644:729; Interrogation_Position=1612; Antisense; TTGGCCAGCCTGAGCAATGCGAGCA
>probe:Drosophila_2:1637779_at:35:159; Interrogation_Position=1637; Antisense; ACAACAACGCATTGGTGACCGCCAC
>probe:Drosophila_2:1637779_at:288:547; Interrogation_Position=1757; Antisense; GGATGGACGGCCAATCCGTTCGAGC
>probe:Drosophila_2:1637779_at:385:81; Interrogation_Position=1835; Antisense; AGGTGATATCCGCTTACCGCGAGAG

Paste this into a BLAST search page for me
GCAGGCGCCTCCAACGGAGCTGGTCCTCACCATTTGTCGCAGCAGCTGCACCCCGCAGTGGCTGGCCTGGGAAATGCCTGGGAAATGTTACGCCCACCGAGATCTCTCGATGAAACCGACCAGCGATGAAACCGACCAGCGGCCTTGGCGGGCCTTGGCGGCAACATGGTCAGCAAACAGCAACAGTTCCGTGACCGGCAGTGACCGGCAACATTAACTCGCAGCTAACTCGCAGCTAAGCGCCGCCAATTTGGCCAGCCTGAGCAATGCGAGCAACAACAACGCATTGGTGACCGCCACGGATGGACGGCCAATCCGTTCGAGCAGGTGATATCCGCTTACCGCGAGAG

Full Affymetrix probeset data:

Annotations for 1637779_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime