FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637781_at:

>probe:Drosophila_2:1637781_at:193:217; Interrogation_Position=1508; Antisense; AAGTTGATCGATTTTGGCATAGCCA
>probe:Drosophila_2:1637781_at:382:557; Interrogation_Position=1546; Antisense; GGACTCGACGAGCATCATCAAATTC
>probe:Drosophila_2:1637781_at:272:37; Interrogation_Position=1559; Antisense; ATCATCAAATTCTCGCAGGCGGGCA
>probe:Drosophila_2:1637781_at:464:67; Interrogation_Position=1575; Antisense; AGGCGGGCACCTTTAACTACATTAG
>probe:Drosophila_2:1637781_at:374:189; Interrogation_Position=1589; Antisense; AACTACATTAGTCCGGAGGCGTTGA
>probe:Drosophila_2:1637781_at:340:365; Interrogation_Position=1630; Antisense; GAATAGCCCGATGCGCAGAGCCGAT
>probe:Drosophila_2:1637781_at:76:97; Interrogation_Position=1668; Antisense; AGATCTCGACCAAATCGGACGTGTG
>probe:Drosophila_2:1637781_at:90:151; Interrogation_Position=1746; Antisense; ACATCCGAAACGTCTATGCCAAGAT
>probe:Drosophila_2:1637781_at:422:97; Interrogation_Position=1767; Antisense; AGATGAGTGCAATCACCACACCGGG
>probe:Drosophila_2:1637781_at:698:667; Interrogation_Position=1823; Antisense; TACTATCCCATCATGCTGGTTCATA
>probe:Drosophila_2:1637781_at:327:25; Interrogation_Position=1845; Antisense; ATATGGCCAAGAACTGCCTACAGTT
>probe:Drosophila_2:1637781_at:148:615; Interrogation_Position=1869; Antisense; TGAATCCCAAAAAGCGGCCGTCGTG
>probe:Drosophila_2:1637781_at:227:501; Interrogation_Position=1888; Antisense; GTCGTGCACCGAACTACTACAGTAC
>probe:Drosophila_2:1637781_at:375:9; Interrogation_Position=1915; Antisense; ATTCCATATGATCATTCCGCTGCAG

Paste this into a BLAST search page for me
AAGTTGATCGATTTTGGCATAGCCAGGACTCGACGAGCATCATCAAATTCATCATCAAATTCTCGCAGGCGGGCAAGGCGGGCACCTTTAACTACATTAGAACTACATTAGTCCGGAGGCGTTGAGAATAGCCCGATGCGCAGAGCCGATAGATCTCGACCAAATCGGACGTGTGACATCCGAAACGTCTATGCCAAGATAGATGAGTGCAATCACCACACCGGGTACTATCCCATCATGCTGGTTCATAATATGGCCAAGAACTGCCTACAGTTTGAATCCCAAAAAGCGGCCGTCGTGGTCGTGCACCGAACTACTACAGTACATTCCATATGATCATTCCGCTGCAG

Full Affymetrix probeset data:

Annotations for 1637781_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720