FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637782_at:

>probe:Drosophila_2:1637782_at:157:631; Interrogation_Position=1065; Antisense; TCCCAAGTACTTGACTCCACATATG
>probe:Drosophila_2:1637782_at:196:209; Interrogation_Position=1090; Antisense; AAGCATATCACTCGCGAATTCTTCC
>probe:Drosophila_2:1637782_at:215:303; Interrogation_Position=1113; Antisense; CCGCGAATTCCGCAAGCTCGAAATA
>probe:Drosophila_2:1637782_at:240:567; Interrogation_Position=1175; Antisense; GGCAGACACCTTATTGTTTTTCCGT
>probe:Drosophila_2:1637782_at:686:663; Interrogation_Position=668; Antisense; TAAAGCTGAACATTGCCCCGGGAAC
>probe:Drosophila_2:1637782_at:554:383; Interrogation_Position=701; Antisense; GAACTCGCTTCTGCTTCAAGGAGGA
>probe:Drosophila_2:1637782_at:647:303; Interrogation_Position=739; Antisense; CCGGCCACCATTCCGGGTGATATTA
>probe:Drosophila_2:1637782_at:645:187; Interrogation_Position=812; Antisense; AACACGACCTGGTCTACAGGCAGTC
>probe:Drosophila_2:1637782_at:143:73; Interrogation_Position=829; Antisense; AGGCAGTCTATTGGCCTGTGCCAGG
>probe:Drosophila_2:1637782_at:446:651; Interrogation_Position=866; Antisense; TCACGTTCTTCATTTGCACGCTGGA
>probe:Drosophila_2:1637782_at:651:129; Interrogation_Position=890; Antisense; ACCGGCGCCAGTTGAAGGTGGTCAT
>probe:Drosophila_2:1637782_at:261:679; Interrogation_Position=923; Antisense; TAGTGCAGCCGGGATACACCAAAGT
>probe:Drosophila_2:1637782_at:249:401; Interrogation_Position=962; Antisense; GACTCCCCAAGTGCCGCAATTTGGA
>probe:Drosophila_2:1637782_at:56:363; Interrogation_Position=977; Antisense; GCAATTTGGATGCAGTTACGGCCAT

Paste this into a BLAST search page for me
TCCCAAGTACTTGACTCCACATATGAAGCATATCACTCGCGAATTCTTCCCCGCGAATTCCGCAAGCTCGAAATAGGCAGACACCTTATTGTTTTTCCGTTAAAGCTGAACATTGCCCCGGGAACGAACTCGCTTCTGCTTCAAGGAGGACCGGCCACCATTCCGGGTGATATTAAACACGACCTGGTCTACAGGCAGTCAGGCAGTCTATTGGCCTGTGCCAGGTCACGTTCTTCATTTGCACGCTGGAACCGGCGCCAGTTGAAGGTGGTCATTAGTGCAGCCGGGATACACCAAAGTGACTCCCCAAGTGCCGCAATTTGGAGCAATTTGGATGCAGTTACGGCCAT

Full Affymetrix probeset data:

Annotations for 1637782_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720