FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637783_at:

>probe:Drosophila_2:1637783_at:449:371; Interrogation_Position=311; Antisense; GAAGGAGTCTCAGCTGGGCCCTGCT
>probe:Drosophila_2:1637783_at:561:435; Interrogation_Position=340; Antisense; GAGGATTCCAAAACCCTGGTCACAG
>probe:Drosophila_2:1637783_at:528:667; Interrogation_Position=379; Antisense; TACTTATTCTCACCGATGCTGCACA
>probe:Drosophila_2:1637783_at:278:161; Interrogation_Position=439; Antisense; ACAATGACCTTCTTTGTCCTTCTGG
>probe:Drosophila_2:1637783_at:250:505; Interrogation_Position=454; Antisense; GTCCTTCTGGGCAACCTGATATTTG
>probe:Drosophila_2:1637783_at:716:545; Interrogation_Position=492; Antisense; GGATGTAGCCATGGTCTCTAAGGTA
>probe:Drosophila_2:1637783_at:545:17; Interrogation_Position=521; Antisense; ATATTTACGGCTATTGGTCGCAGGC
>probe:Drosophila_2:1637783_at:693:497; Interrogation_Position=547; Antisense; GTCTCGTTGAATGCCGCCATATTTG
>probe:Drosophila_2:1637783_at:365:643; Interrogation_Position=641; Antisense; TCTTTTTCGTCCTTTATCCCATAAT
>probe:Drosophila_2:1637783_at:443:333; Interrogation_Position=685; Antisense; GCTGGATTCATGTTGCCTATATTTG
>probe:Drosophila_2:1637783_at:657:621; Interrogation_Position=715; Antisense; TGCTGTATGGCGCTGTACTGTATAT
>probe:Drosophila_2:1637783_at:304:17; Interrogation_Position=775; Antisense; ATTTTCATCAACTTTGTCTGCCCGT
>probe:Drosophila_2:1637783_at:195:305; Interrogation_Position=796; Antisense; CCGTTCATATTCGTGTGGCAGCAGC
>probe:Drosophila_2:1637783_at:74:93; Interrogation_Position=827; Antisense; AGTTCAACATTCACGGGCCCTGGGA

Paste this into a BLAST search page for me
GAAGGAGTCTCAGCTGGGCCCTGCTGAGGATTCCAAAACCCTGGTCACAGTACTTATTCTCACCGATGCTGCACAACAATGACCTTCTTTGTCCTTCTGGGTCCTTCTGGGCAACCTGATATTTGGGATGTAGCCATGGTCTCTAAGGTAATATTTACGGCTATTGGTCGCAGGCGTCTCGTTGAATGCCGCCATATTTGTCTTTTTCGTCCTTTATCCCATAATGCTGGATTCATGTTGCCTATATTTGTGCTGTATGGCGCTGTACTGTATATATTTTCATCAACTTTGTCTGCCCGTCCGTTCATATTCGTGTGGCAGCAGCAGTTCAACATTCACGGGCCCTGGGA

Full Affymetrix probeset data:

Annotations for 1637783_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720