FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637784_at:

>probe:Drosophila_2:1637784_at:600:575; Interrogation_Position=1480; Antisense; GGCGAAGGCTACCTCGTAGACGAAT
>probe:Drosophila_2:1637784_at:346:307; Interrogation_Position=1509; Antisense; CCAGGGCGACGGACTCATGAGGCAT
>probe:Drosophila_2:1637784_at:179:57; Interrogation_Position=1525; Antisense; ATGAGGCATCCACAACAGCGCAAAC
>probe:Drosophila_2:1637784_at:244:71; Interrogation_Position=1564; Antisense; AGGCGAGCCGTTAGCGGAACTCCAA
>probe:Drosophila_2:1637784_at:649:153; Interrogation_Position=1598; Antisense; ACAGCGACGGTTGCGAGTATCAAAT
>probe:Drosophila_2:1637784_at:455:33; Interrogation_Position=1616; Antisense; ATCAAATCAATGTGTCGCGTTCCCG
>probe:Drosophila_2:1637784_at:487:293; Interrogation_Position=1633; Antisense; CGTTCCCGCTGCTCTAATGATAAGA
>probe:Drosophila_2:1637784_at:389:203; Interrogation_Position=1669; Antisense; AACCTTGGGCGCAAAAGCTTTAGCT
>probe:Drosophila_2:1637784_at:637:115; Interrogation_Position=1684; Antisense; AGCTTTAGCTTTACGAATCCCCAAG
>probe:Drosophila_2:1637784_at:694:365; Interrogation_Position=1698; Antisense; GAATCCCCAAGTGCGCGAGATCGAG
>probe:Drosophila_2:1637784_at:235:59; Interrogation_Position=1750; Antisense; ATGATGACTGTGAAGCCCACGGCGA
>probe:Drosophila_2:1637784_at:493:575; Interrogation_Position=1770; Antisense; GGCGACGATCAAGGCTAGCACCAGT
>probe:Drosophila_2:1637784_at:694:307; Interrogation_Position=1850; Antisense; CCAGCGCAGCTGTGAACCGGAAGAA
>probe:Drosophila_2:1637784_at:148:73; Interrogation_Position=1969; Antisense; AGGCAGCTCCAACTGTGTTCATTAA

Paste this into a BLAST search page for me
GGCGAAGGCTACCTCGTAGACGAATCCAGGGCGACGGACTCATGAGGCATATGAGGCATCCACAACAGCGCAAACAGGCGAGCCGTTAGCGGAACTCCAAACAGCGACGGTTGCGAGTATCAAATATCAAATCAATGTGTCGCGTTCCCGCGTTCCCGCTGCTCTAATGATAAGAAACCTTGGGCGCAAAAGCTTTAGCTAGCTTTAGCTTTACGAATCCCCAAGGAATCCCCAAGTGCGCGAGATCGAGATGATGACTGTGAAGCCCACGGCGAGGCGACGATCAAGGCTAGCACCAGTCCAGCGCAGCTGTGAACCGGAAGAAAGGCAGCTCCAACTGTGTTCATTAA

Full Affymetrix probeset data:

Annotations for 1637784_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720